ID: 1076544887

View in Genome Browser
Species Human (GRCh38)
Location 10:131238590-131238612
Sequence GAGATAATGAACATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544887_1076544891 2 Left 1076544887 10:131238590-131238612 CCTTCCTCCATGTTCATTATCTC 0: 1
1: 0
2: 3
3: 29
4: 354
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data
1076544887_1076544892 18 Left 1076544887 10:131238590-131238612 CCTTCCTCCATGTTCATTATCTC 0: 1
1: 0
2: 3
3: 29
4: 354
Right 1076544892 10:131238631-131238653 GCTGCGGTTCTTTGTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544887 Original CRISPR GAGATAATGAACATGGAGGA AGG (reversed) Intronic
900809688 1:4792691-4792713 GAGATAATGAAGATTCAGGGAGG - Intergenic
901186489 1:7376689-7376711 CAGGTTGTGAACATGGAGGATGG + Intronic
901957112 1:12794367-12794389 CAGATAATGAACTCGAAGGACGG + Exonic
901980514 1:13030499-13030521 CAGATAATGAACTCGAAGGACGG + Intronic
902001574 1:13198432-13198454 CAGATAATGAACTCGAAGGACGG - Intergenic
902020806 1:13344142-13344164 CAGATAATGAACTCGAAGGACGG - Exonic
902618971 1:17639547-17639569 GAGAGAAGGGAGATGGAGGAAGG - Intronic
903300765 1:22377072-22377094 CACATACTGAGCATGGAGGAGGG - Intergenic
903915317 1:26759608-26759630 TAGAGAATGAACATGGGGCAGGG + Intronic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
905387556 1:37614845-37614867 GAAAGAATCAGCATGGAGGAGGG + Intronic
906095096 1:43217564-43217586 GAGGTAAGGATCATGGATGAAGG - Intronic
906702889 1:47872600-47872622 GAGAGAATGAAGATGGAGTGAGG + Intronic
906841119 1:49140377-49140399 GAGATGTTGAACCTGGAGAAGGG - Intronic
907590940 1:55670505-55670527 GAGATCATGAATATGAAGCAAGG + Intergenic
908479188 1:64520400-64520422 GTGTTAATGAACATGGATGGTGG + Intronic
910422141 1:87077503-87077525 GAGGTAATTAATATGTAGGATGG - Intronic
911763324 1:101641943-101641965 GAGATATTTAACATGGAGTCTGG + Intergenic
912005914 1:104901734-104901756 AAGATATTGATAATGGAGGAAGG + Intergenic
912308572 1:108596077-108596099 GAGATAGTGAACAGGAAGTAAGG + Intronic
915809972 1:158898383-158898405 GAGAAAAGGAACATGTAGAAGGG - Intergenic
916449701 1:164908352-164908374 TAGATAATGAAAAGGTAGGAGGG - Intergenic
917501031 1:175585205-175585227 GAGGTATGGAAGATGGAGGAGGG + Intronic
917660988 1:177176648-177176670 AAGAGAAAGAACATGGAGGGAGG + Intronic
920139916 1:203802525-203802547 CAGATAATAAAGATGGGGGAAGG + Exonic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
922004659 1:221517615-221517637 AAGACAATGAACAAGGAGGAGGG + Intergenic
922020783 1:221702351-221702373 GAGACAATGAGGAAGGAGGATGG - Exonic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922453298 1:225754021-225754043 GAGAAAAAGGGCATGGAGGAGGG - Intergenic
922519000 1:226230106-226230128 GTGATAATGAAGATGGAGAGAGG + Intergenic
923140305 1:231156330-231156352 GAGATGATGAAAATGAAGAAAGG - Intergenic
923281244 1:232445257-232445279 GAGCCAGTGGACATGGAGGAAGG + Intronic
924692435 1:246364008-246364030 GAGAAAAAGAACCTGGAAGATGG + Intronic
1062894774 10:1094898-1094920 GAGGTAATGAACATGGAGAGAGG + Intronic
1062894818 10:1095152-1095174 GAGGTAATGAACATGGAGAGGGG + Intronic
1063342537 10:5281272-5281294 CAGAAACTGAATATGGAGGAAGG - Intergenic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1065383967 10:25115473-25115495 GAGATGAGGAACAGGGAGGGAGG - Intergenic
1068794599 10:61064773-61064795 GAGATAGTGAATGTGCAGGAGGG - Intergenic
1070122122 10:73588026-73588048 GAGATAATGCATATAGAGGATGG - Intronic
1070641016 10:78169924-78169946 GAGACAAAGAACAAAGAGGAAGG - Intergenic
1072272565 10:93791130-93791152 GAGGTAATAGACATGGAGGAGGG - Intronic
1073146556 10:101285378-101285400 GAGGGGATGAAAATGGAGGATGG - Intergenic
1075878503 10:125828243-125828265 AGGATAACAAACATGGAGGAAGG + Intronic
1076126298 10:127976729-127976751 GAGCTACTGAACTTGGGGGAGGG - Intronic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076238225 10:128882433-128882455 GAGAAAAGGAACATGGAGACTGG + Intergenic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076544887 10:131238590-131238612 GAGATAATGAACATGGAGGAAGG - Intronic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1079299718 11:19267187-19267209 GAGAGAAGGAACAAGGAGGAGGG - Intergenic
1079599702 11:22295686-22295708 GAGGTCATGCACATTGAGGAAGG + Intergenic
1080292120 11:30682726-30682748 TAGAGAGTGGACATGGAGGAAGG + Intergenic
1080469008 11:32526983-32527005 GAGATAATGAACTTTGGGGGCGG - Intergenic
1080546912 11:33329672-33329694 GGAATTCTGAACATGGAGGAGGG - Intronic
1080923924 11:36736517-36736539 GAAATAATGAAAAGGGATGAAGG - Intergenic
1084483647 11:69435882-69435904 GATATAGGCAACATGGAGGAAGG + Intergenic
1085931520 11:81089061-81089083 GAGAAAATGAAGATGGAGTGAGG - Intergenic
1086437507 11:86796926-86796948 GAGCTAGAGAACATGGAAGAGGG - Intronic
1086979823 11:93182666-93182688 AAGGTAATGAATATGGAAGAAGG - Intronic
1087080622 11:94167842-94167864 GAAAAAATAAACATGGAAGAAGG + Intronic
1087280114 11:96200593-96200615 GAAATAATTAAAATGCAGGAGGG - Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088966560 11:114728069-114728091 CTGATTTTGAACATGGAGGACGG - Intergenic
1090214825 11:124952771-124952793 GAGATAGTGAAGATGGTGGAAGG - Intergenic
1090630856 11:128646033-128646055 GAGATAAGGAAAAAGAAGGAAGG + Intergenic
1090643776 11:128750946-128750968 GAGATAATGAAAATGGTAGGTGG - Intronic
1094059902 12:26302526-26302548 GAGAGTGTGAACATGAAGGAAGG - Intergenic
1095396565 12:41768803-41768825 AAGGTAATGAGCATGGAGCAGGG + Intergenic
1095567303 12:43640506-43640528 GAGATAGAGAACATGGAGGAGGG - Intergenic
1099258793 12:80349456-80349478 GAGAACATGACCATTGAGGATGG + Intronic
1099545748 12:83977693-83977715 TAGATAATGCATATGGATGAAGG - Intergenic
1099652619 12:85447761-85447783 GAGATGATGAAGATGTAGGTGGG + Intergenic
1102394455 12:112574854-112574876 GGGATAATGAAGGTGGAGGAAGG + Intronic
1103175256 12:118857954-118857976 GAGACAGTGAACATGGTGAAAGG + Intergenic
1105389495 13:19960638-19960660 AAGATGATCAACATGGAAGATGG - Intronic
1105974050 13:25457486-25457508 GAGATAATAAAAATGGGGCAAGG - Intronic
1106071508 13:26416456-26416478 AAGATAATGGTCAAGGAGGAAGG - Intergenic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1111009564 13:82293588-82293610 AAGTTAATGAAAATGGAAGAAGG + Intergenic
1111635559 13:90898910-90898932 CAGATAAAGAACATGATGGAAGG - Intergenic
1112753563 13:102606114-102606136 GAGCTAAGGAGCATGAAGGATGG + Intronic
1115489139 14:33942037-33942059 TAGATAATGAAGAAGGAGCATGG + Intronic
1115621108 14:35141697-35141719 GAGTTAATAATCATGGAGGATGG - Intronic
1116041186 14:39687933-39687955 GAGAAAATGAACAGGAAAGAAGG - Intergenic
1116551335 14:46242861-46242883 GAGATAAGATAGATGGAGGAAGG + Intergenic
1117025679 14:51617484-51617506 GAGATAACGAACATGAATGTGGG + Intronic
1117709031 14:58504392-58504414 GAGAGAGCGAATATGGAGGAAGG + Intronic
1117911186 14:60639814-60639836 GAGAAAATGCACATGTATGAGGG - Intergenic
1118272180 14:64353727-64353749 GATATAATGAGCATTGATGAGGG - Intergenic
1118396743 14:65344233-65344255 GAGATAATCTACCTGGAGGGTGG - Intergenic
1119646339 14:76351134-76351156 GAGAAAAAGAACCTGGATGAGGG + Intronic
1121944729 14:98108635-98108657 GAGGAAATGAACATAAAGGAAGG - Intergenic
1122064962 14:99166477-99166499 CAGAGAATGCACATGGAGGTTGG - Intergenic
1124237254 15:28001617-28001639 AAAATAAAGAACAAGGAGGAAGG + Intronic
1124561145 15:30774510-30774532 GAGAAAATGACCATTGATGAAGG - Intergenic
1124669385 15:31624549-31624571 GAGAAAATGACCATTGATGAAGG + Intronic
1125452679 15:39825421-39825443 GAAATAATGATAATGGAGAAAGG - Intronic
1127211857 15:56781749-56781771 CATATAATGAACAGTGAGGACGG - Intronic
1127254076 15:57273597-57273619 GACATAAAGAGCAGGGAGGAGGG - Intronic
1127941580 15:63703202-63703224 GAGAAAGTGAATATGTAGGAAGG - Intronic
1129113019 15:73349148-73349170 GAGAGAATGAGAATGGAGGCTGG - Intronic
1129139523 15:73584655-73584677 GAGAGAAGGAAGATGGAGCAGGG - Intronic
1131394389 15:92075122-92075144 GTGACAAGGAACATGGAGCACGG - Intronic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1133487445 16:6233794-6233816 GTGACAGAGAACATGGAGGACGG - Intronic
1134762913 16:16729840-16729862 GAGGGAATGAGCATTGAGGAAGG - Intergenic
1134983139 16:18629309-18629331 GAGGGAATGAGCATTGAGGAAGG + Intergenic
1137258874 16:46805206-46805228 CAGATAAGGAACATGGAAGATGG - Intronic
1137642780 16:50047479-50047501 CAGATAAAGAACCTGGAGAAAGG + Intergenic
1138052024 16:53788641-53788663 GAGATAATGGAGATAGAGGTTGG - Intronic
1139095217 16:63697007-63697029 GGGATAATCGAAATGGAGGAAGG - Intergenic
1145752994 17:27368513-27368535 GAGATGAAGGACATGAAGGAGGG - Intergenic
1146627125 17:34443344-34443366 GGGAGAAAGAAAATGGAGGAAGG - Intergenic
1147429283 17:40361815-40361837 GGGAGGATGAAGATGGAGGAGGG + Intronic
1148837360 17:50472431-50472453 CGGATCATGAACATGGAGGCAGG + Exonic
1149464016 17:56859859-56859881 GAGACAATGAGCAGGGAGTAAGG + Intronic
1150441837 17:65197573-65197595 AATATAATGAACCTGGAGGAAGG + Intronic
1152470680 17:80488932-80488954 GAGAGGATGGACATGGTGGAGGG + Intergenic
1152470763 17:80489221-80489243 GAGAGGATGGACATGGTGGAGGG + Intergenic
1152470795 17:80489330-80489352 GAGAGGATGGACATGGTGGAGGG + Intergenic
1152470872 17:80489579-80489601 GAGAGGATGGACATGGTGGAGGG + Intergenic
1152470949 17:80489828-80489850 GAGAGGATGGACATGGTGGAGGG + Intergenic
1152523068 17:80871657-80871679 AAGATAATGAAACTGCAGGAAGG - Intronic
1152912360 17:83012667-83012689 GAGATATCGCACATGGAGGCTGG - Intronic
1152984704 18:311210-311232 GAGATGGAGAATATGGAGGAAGG + Intergenic
1153467151 18:5400567-5400589 GTGATAAAGAAAATGCAGGAAGG - Intronic
1153849036 18:9076349-9076371 GACATAATTAGGATGGAGGAGGG + Intergenic
1155321948 18:24628213-24628235 GTGATAATAAACAAGAAGGAGGG + Intergenic
1156018781 18:32576256-32576278 GAGAAACTGAACATGGAGACAGG - Intergenic
1156659287 18:39327551-39327573 GAGCTAATCAGCATGGAGAAAGG + Intergenic
1157356376 18:46938825-46938847 TAGATAATGATACTGGAGGAAGG - Intronic
1158226905 18:55210859-55210881 GAGATAATAAAGATGAAGTAAGG + Intergenic
1158897050 18:61923880-61923902 GAATGAATGAACATGAAGGATGG - Intergenic
1160365386 18:78320237-78320259 CAGATAATGAAAATGGCAGAAGG - Intergenic
1160410931 18:78675063-78675085 GAGATAAGGAAGATGGAAAAGGG - Intergenic
1160786331 19:901623-901645 GAGATGATAAAAAAGGAGGAAGG - Intronic
1162841949 19:13363296-13363318 GAGAGAATGAATATGGGGCAGGG - Intronic
1162883068 19:13674682-13674704 GAAATAATGAAAATTGAGGCTGG - Intergenic
1165159717 19:33808809-33808831 GAGATAGAGAAGATGGAGCAAGG + Intronic
1166113793 19:40640463-40640485 GTGATAATGACCTTGGAGGGAGG + Intergenic
1167559617 19:50217962-50217984 GAGACAATGAACATGGAGACAGG - Intronic
925277103 2:2657851-2657873 GAGAGGAAGAACATGAAGGAGGG - Intergenic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
926364611 2:12121711-12121733 ATGATAATGCCCATGGAGGAAGG - Intergenic
926395407 2:12436464-12436486 GAGACAAAAATCATGGAGGAGGG - Intergenic
927089551 2:19700209-19700231 GAGATGATGTGCATGGAGGATGG + Intergenic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
928669386 2:33585256-33585278 GAGGTCATGAACAAGGAGGCGGG - Exonic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
930323981 2:49890009-49890031 GAGAAAATGAATAGAGAGGAAGG - Intergenic
930449208 2:51513257-51513279 GAAAGAATGAACATGCAGAAAGG + Intergenic
930994234 2:57697095-57697117 GAGATAATGCCCTAGGAGGATGG - Intergenic
931925875 2:67071864-67071886 GAGATAAGGAAATTGGAGAAGGG + Intergenic
931942306 2:67266052-67266074 GAGAAAGTGATCATGGGGGAGGG + Intergenic
932360778 2:71103895-71103917 GAGATCATGCAAATGAAGGAAGG - Intergenic
932886305 2:75552349-75552371 GAGAGAAGGGACAGGGAGGAGGG - Intronic
933008949 2:77032274-77032296 GATATAATGAAAATTGAGCAAGG - Intronic
934768412 2:96893482-96893504 GTGAAAATGAACAGGGAGGCTGG + Intronic
935936946 2:108196140-108196162 GAAATCATAAACATGGAAGAAGG - Intergenic
936464376 2:112734103-112734125 GAGATAACGGACATGGAGCTTGG + Intronic
936478813 2:112866261-112866283 GAGATGAAGAACAGGTAGGAGGG - Intergenic
936511404 2:113150425-113150447 GAATCAATGAGCATGGAGGAGGG - Intergenic
936893168 2:117395765-117395787 GAGATAATGACCTGGGAGTAAGG + Intergenic
937238279 2:120443513-120443535 GAGAAAACTAACATGGCGGAGGG - Intergenic
938230425 2:129654390-129654412 GGGACAATGAACACGGAGCAGGG + Intergenic
939626337 2:144482114-144482136 GAGAAAATGAACGGGGAGAAGGG - Intronic
939927977 2:148197602-148197624 AAAATAATGAATATGGAGAAGGG - Intronic
940516505 2:154690703-154690725 TAAATAATGAACATGGATGGGGG - Intergenic
940858461 2:158748516-158748538 GAGACAATGAACATGGAGGTGGG - Intergenic
941470308 2:165876891-165876913 GAGTTAATGAACTTGGAGTATGG + Intronic
941551935 2:166927602-166927624 AAGATAATAAAAATGGAAGAGGG - Intronic
943549876 2:189325386-189325408 AGGAGAAGGAACATGGAGGATGG - Intergenic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945241871 2:207683614-207683636 CAGATAATGGACAGCGAGGAGGG - Intergenic
945506881 2:210652597-210652619 GAGATAGGGAACACTGAGGAAGG + Intronic
945685248 2:212960971-212960993 GAGACAAGGAAGAGGGAGGAAGG + Intergenic
946488078 2:220120113-220120135 GAGCTGGTGAACATGGAGGTAGG + Intergenic
946520980 2:220464463-220464485 GAGATTGTAAACATGCAGGATGG - Intergenic
947046693 2:225995133-225995155 AAGGAAAGGAACATGGAGGATGG + Intergenic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
1170135910 20:13073562-13073584 ATGATAATGAACTTGGTGGAAGG + Intronic
1170412886 20:16109378-16109400 TACATATTGAACAAGGAGGAAGG - Intergenic
1170519986 20:17175114-17175136 AAGGCAAGGAACATGGAGGATGG + Intergenic
1170701669 20:18709396-18709418 GAAATAATGACCATGAGGGAGGG - Intronic
1171465807 20:25327127-25327149 TAGCTAATGAAGATGGAGAAAGG - Intronic
1172121477 20:32601502-32601524 GAGATCATGTTCCTGGAGGAGGG - Exonic
1172357081 20:34287717-34287739 GAGAAGATGAACAAGGAGAAGGG + Intronic
1172695306 20:36818274-36818296 GATAAAATGAATATGGAGGCTGG + Intronic
1172964966 20:38828119-38828141 GAGAAAAACAACATGAAGGAAGG - Intronic
1173439613 20:43064454-43064476 GAGAGGATGACCATAGAGGAGGG - Intronic
1174287868 20:49484676-49484698 GAAATAATGAAACAGGAGGAAGG + Intergenic
1174384391 20:50178494-50178516 GAGCCAAGGAACATGGTGGATGG + Intergenic
1177528194 21:22325726-22325748 GATATAATGAACACGGTGTAAGG - Intergenic
1177720994 21:24906803-24906825 GCGAGAATGAACAAAGAGGATGG - Intergenic
1178482213 21:32989402-32989424 GAGAAACTCAACATGGAGGTGGG - Intergenic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1180130722 21:45825341-45825363 GAGATGACGATCAGGGAGGAGGG - Intronic
1180558619 22:16597687-16597709 TAGAAAATAAACATGGAGGCCGG - Intergenic
1181879415 22:25966147-25966169 GAGAAAATGAACAGGGAGAGAGG - Intronic
1181982847 22:26778321-26778343 GATATAATGAAGATGGAGGCTGG - Intergenic
1182618706 22:31605984-31606006 GAGACAGGGAACCTGGAGGAAGG - Intronic
1183913210 22:41094167-41094189 GGGATAATGAAGATGAAGAATGG + Intronic
1184244701 22:43230162-43230184 GAGCGAATGAATGTGGAGGAAGG + Intronic
1184474135 22:44711534-44711556 GAGTTAATGAAAAGGAAGGAAGG + Intronic
1184561181 22:45263748-45263770 GGCATGGTGAACATGGAGGAGGG + Intergenic
1185193677 22:49454780-49454802 GAGATAGTCAACAAGGAGGAAGG + Intronic
1185350076 22:50330807-50330829 GAGAAAAAGAACCTGGAAGATGG + Intergenic
949797832 3:7870199-7870221 GAGGTCCTGAAGATGGAGGAAGG + Intergenic
951024195 3:17812968-17812990 GAGATACTGCTCCTGGAGGAGGG + Intronic
953250158 3:41238504-41238526 TGGGTAATGAACATGGAGGATGG + Intronic
955033931 3:55248192-55248214 GAGATAATGAAGGTGGGAGATGG + Intergenic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
959174626 3:102890986-102891008 GAAATAAAGAAGATGAAGGAGGG - Intergenic
960286661 3:115837557-115837579 GAGTTAATGAAAATGGAAGTGGG + Intronic
960394866 3:117124467-117124489 GAGCTGATGAAGATAGAGGAAGG + Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
962381626 3:134902980-134903002 CAGATAATGAACATGGAGTTAGG + Intronic
963414741 3:144980808-144980830 AGTATAATGAACATGAAGGAAGG + Intergenic
963429816 3:145185473-145185495 GAGATAATTAAAATGGACAAAGG - Intergenic
965238970 3:166168848-166168870 CATATAATGAACATAAAGGAAGG + Intergenic
965486904 3:169289451-169289473 TAAATAATGAACAAGAAGGAAGG - Intronic
965495927 3:169398969-169398991 GAGATGATGAACATGGAGAGTGG - Intronic
965523456 3:169691868-169691890 GAGAGAAAGAACAAAGAGGAGGG + Intergenic
965644302 3:170864025-170864047 GAAGTAATGAACAGTGAGGATGG - Intergenic
966806667 3:183813205-183813227 GAGACAATGAACATTTATGAAGG - Intergenic
967849839 3:194073436-194073458 GTGAGAATGCACCTGGAGGAAGG + Intergenic
969117928 4:4885194-4885216 GACATGATGAAAATGCAGGATGG + Intergenic
969182947 4:5456030-5456052 GAGATAATGTTCATGGGGGTTGG + Intronic
970723217 4:19012221-19012243 AAGAGAATGAACATGGAAGAAGG - Intergenic
970765014 4:19538124-19538146 GAGACAATGAAGATGGATTATGG - Intergenic
970916626 4:21343465-21343487 GAGATAATAAACTTGCAAGATGG - Intronic
971792519 4:31186789-31186811 GACCTAATGATCATGGTGGAAGG + Intergenic
972062377 4:34892636-34892658 AAGATAACAATCATGGAGGAAGG - Intergenic
972480437 4:39491383-39491405 GGGATAGGGGACATGGAGGAGGG - Intergenic
972781323 4:42289117-42289139 GACATAAGGAGCATGGACGAGGG + Intergenic
973141970 4:46780821-46780843 GAGATGATGAGTATGGAGCAAGG - Intronic
974520498 4:62975664-62975686 GACATAAGGGACATGGATGAGGG - Intergenic
974687834 4:65253689-65253711 GAGAGAATTAGCAGGGAGGAGGG + Intergenic
974919157 4:68216048-68216070 GAGATAATCAATATGGAAAACGG - Intergenic
975399299 4:73916224-73916246 GAGATGATGAATATTGATGATGG + Intergenic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
977821302 4:101475401-101475423 GAAATAAACATCATGGAGGAGGG + Intronic
977842869 4:101730166-101730188 GGAAGAAAGAACATGGAGGAGGG - Intronic
977878830 4:102181228-102181250 GAGGTAATGTAGATGGAGAAAGG - Intergenic
977895289 4:102357696-102357718 GAGAGAGTGAGCAGGGAGGAAGG + Intronic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979451939 4:120882449-120882471 GACAAAATGAAGATGGAAGAAGG - Intronic
979919710 4:126480851-126480873 GAGAAGCTGAACAGGGAGGACGG - Intergenic
979957617 4:126973963-126973985 TAGAAAACAAACATGGAGGATGG + Intergenic
982117056 4:152106628-152106650 GAGAGAATGGACATGGAGGATGG - Intergenic
982363942 4:154554311-154554333 CAGCTACTGAACATGTAGGAAGG + Intergenic
982496684 4:156103399-156103421 GAGAGAATGAGAATGGAGGGTGG + Intergenic
982711161 4:158759818-158759840 GAGATAGCGAACATCGAGAACGG + Intergenic
983640840 4:169942686-169942708 GAGGTAATGAACTTGGGGGTGGG - Intergenic
985471826 5:51276-51298 GAGATGATGAAAAGGAAGGAAGG - Intergenic
985717741 5:1472098-1472120 GAGATAATGAGCACCCAGGATGG + Intronic
985983144 5:3488869-3488891 GAGATAATGATGATAGAGAAAGG - Intergenic
987217809 5:15756454-15756476 TAGATTATGAAAATGGAGAAAGG - Intronic
987277740 5:16379366-16379388 GAGGTGATGAATATGGTGGATGG + Intergenic
987982774 5:25108925-25108947 AAGATAAAGAAAATGAAGGAGGG - Intergenic
988457063 5:31395735-31395757 GACATAAGGGGCATGGAGGAGGG + Intergenic
989165181 5:38426774-38426796 GAGAGAAAGAGCATGGAGGATGG + Intronic
989453588 5:41615550-41615572 GAGAGAAAGAACAGAGAGGAAGG - Intergenic
990387674 5:55283203-55283225 GTGAAAATGGACCTGGAGGAAGG - Exonic
991124180 5:63051018-63051040 GAAATAATGATCATGAAAGAAGG + Intergenic
991257579 5:64631796-64631818 GAAATATTGATCATGTAGGAAGG + Intergenic
991524129 5:67537527-67537549 GAAATTATAAATATGGAGGATGG + Intergenic
992729952 5:79654133-79654155 GAGTTAATGAAAAAGGAGGCCGG + Intronic
992828625 5:80572737-80572759 CAGATATTGAAGATGGAGGAAGG - Intergenic
993601336 5:89928683-89928705 GAAATCAAGAACAAGGAGGAAGG + Intergenic
993771173 5:91929494-91929516 GTGACAATGAAAATGGAAGAGGG + Intergenic
995927425 5:117391508-117391530 GAAATAAAGGACATAGAGGATGG + Intergenic
996099157 5:119429778-119429800 GGCATAGTGAACATGGATGAGGG + Intergenic
996803889 5:127433338-127433360 GAAATAATGCACATGGGGCAAGG - Intronic
997378519 5:133417437-133417459 GAGATAATGAATAGGGCAGAAGG + Intronic
998436453 5:142113339-142113361 GAAGTAATGATCCTGGAGGAAGG + Intronic
999371982 5:151061335-151061357 GGGAAAATGTAGATGGAGGAGGG - Intronic
1000012560 5:157246186-157246208 GAGATACTGGACATGGTGGTGGG + Intronic
1000703655 5:164484865-164484887 GAGATAAGAAATAGGGAGGAAGG + Intergenic
1000725663 5:164767592-164767614 GACATACAGAACATGGAGAAGGG - Intergenic
1002397574 5:178970024-178970046 CAGTTAGTGAATATGGAGGAAGG - Intergenic
1002688790 5:181036517-181036539 GAGAAAATGAAAATGCAGTAAGG + Intergenic
1002945587 6:1758246-1758268 GAGATAATGACCAAGAAGGGAGG - Intronic
1002946189 6:1763538-1763560 GTGAGAATGAACATGATGGATGG + Intronic
1005089045 6:22037160-22037182 GAGAAAAGGACCATGTAGGAAGG + Intergenic
1005264048 6:24092484-24092506 GAGATTCAGAACACGGAGGAGGG + Intergenic
1007563060 6:42826529-42826551 GAGGTTAAGAACATGGAGGCTGG - Intronic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1008978689 6:57457917-57457939 AAGAAAATGAACAAGGAAGATGG - Intronic
1009166824 6:60350876-60350898 AAGAAAATGAACAAGGAAGATGG - Intergenic
1010034747 6:71311850-71311872 CAGATAATGAAGGTGAAGGATGG + Intergenic
1010126967 6:72443710-72443732 AAAATAATGAAGAAGGAGGAAGG + Intergenic
1010187630 6:73161800-73161822 GAGATGATGAAGAGAGAGGATGG - Intronic
1010320538 6:74504168-74504190 GAGATAATCTGCATGGGGGAGGG + Intergenic
1011238343 6:85242652-85242674 CAGTTAATGAACAGGCAGGATGG - Intergenic
1011861393 6:91761624-91761646 GAGATAATTAGCAAGGAGAAGGG + Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1013751386 6:113410746-113410768 GAGAAAAAGAAAGTGGAGGAGGG + Intergenic
1014554176 6:122825876-122825898 GAGATGTTGAAAATGGAGGCAGG - Intergenic
1015180595 6:130357587-130357609 GGGATAATGAACATGAAGACAGG + Intronic
1020246709 7:6435088-6435110 CAGAAACTGAACCTGGAGGAGGG - Intronic
1021037695 7:15821059-15821081 GAGCTAATGATAAAGGAGGATGG + Intergenic
1021816549 7:24452702-24452724 GAGTTAGTGAAGATGGGGGAAGG + Intergenic
1022651946 7:32285660-32285682 GAGAAAAGGAACAGGAAGGAAGG + Intronic
1022835163 7:34106434-34106456 GAGAAAATGAATGTGGAGCATGG + Intronic
1023439267 7:40169566-40169588 GACATAATAGACATGGACGAAGG + Intronic
1023484682 7:40673182-40673204 AAGATAACAGACATGGAGGATGG - Intronic
1024143515 7:46486266-46486288 GACAGAGTGAACATGGAGGAAGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1028515374 7:91672220-91672242 GTGATAATGAACATAGAATATGG + Intergenic
1028572299 7:92304010-92304032 GAGATAATTAACAGGAAGGTGGG - Intronic
1028889313 7:95969259-95969281 AAGATAAGGAAGATGGTGGAGGG + Intronic
1029991157 7:104963754-104963776 AAGATCATGAACATGTGGGAAGG - Intergenic
1030927546 7:115477102-115477124 GAGAAAATGAAAAGGAAGGAGGG + Intergenic
1032259205 7:130321338-130321360 GAGATAATGGATACGGAGAAGGG - Intronic
1032382109 7:131495997-131496019 GACAAAATGAACATGAAGCAAGG + Exonic
1032439698 7:131933081-131933103 GAGACAATGAGCATGGAGTGTGG - Intergenic
1032511669 7:132477449-132477471 CAGATAAATAACATGGAGCAGGG + Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1033963641 7:146946154-146946176 GAGAGAAAGAAAAGGGAGGAAGG - Intronic
1034187933 7:149193793-149193815 AAGCTGATGAAGATGGAGGAGGG - Intergenic
1034242793 7:149623168-149623190 GTAATAATGCACGTGGAGGATGG - Intergenic
1034253126 7:149708101-149708123 GAGATGATGAACATGGAGTTGGG + Intergenic
1034618693 7:152440323-152440345 TAGAAAATAAACATGGAGGCCGG + Intergenic
1035987255 8:4448091-4448113 GAGATCAAGAACATAGAGAAGGG - Intronic
1037488669 8:19375609-19375631 GAGAGAAGGAACATAGGGGATGG + Intronic
1038338434 8:26663758-26663780 GAGAGAATGAACAGAGAAGATGG - Intergenic
1038776674 8:30537584-30537606 GAGCTAATGAACATGGAGAGAGG + Intronic
1039407573 8:37326410-37326432 GAGAAAAGGAACAAGGAGAAAGG - Intergenic
1039655586 8:39401332-39401354 GAGAGAAGTTACATGGAGGAGGG + Intergenic
1039890913 8:41684627-41684649 GAGATCGTGAACATGCTGGAGGG - Exonic
1040485911 8:47870993-47871015 GAATTAATGAACATGTAGGCAGG + Intronic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1043489998 8:80739826-80739848 GACATAAGGGACATGGACGAGGG - Intronic
1044483017 8:92714835-92714857 AAGATAATGAACATAAAAGAAGG + Intergenic
1045327692 8:101128827-101128849 GAGCTCATGGACATGGAGCAAGG + Intergenic
1045816248 8:106280478-106280500 GAGATGATGAAGATGGAGACTGG - Intronic
1045929247 8:107603680-107603702 GACATATTGGACATGGATGAGGG + Intergenic
1046183392 8:110682222-110682244 GAGAAAATTAAGATTGAGGAGGG - Intergenic
1049990826 9:990172-990194 GAGATAGTGTCCGTGGAGGAAGG + Exonic
1052334351 9:27304401-27304423 GAGATCATGAAAATGCAGAAAGG + Intergenic
1052473617 9:28930714-28930736 GAGAAAATTAAAATGGAGGGAGG + Intergenic
1054799475 9:69333188-69333210 TAGATTGTTAACATGGAGGAGGG + Intronic
1056401236 9:86229531-86229553 TACATACTGAACATTGAGGAAGG + Exonic
1056418748 9:86403080-86403102 GAGAGAATGAACAGGGAAGCTGG - Intergenic
1056986951 9:91372090-91372112 GAGAACATGAACAGGGAGGCAGG - Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058185985 9:101855426-101855448 TAGATAACCAACATGGAGAAAGG + Intergenic
1058415605 9:104785485-104785507 AAGATAATGAAGATGGAAGCTGG + Exonic
1059799585 9:117736808-117736830 TAGAAAATGAATATGGAGCAAGG - Intergenic
1059828976 9:118070158-118070180 GAAACAATGAACATGGGAGAAGG - Intergenic
1061479690 9:130891278-130891300 GAGATAAAGAACACGGGGGCGGG - Intergenic
1061511751 9:131065838-131065860 AAGATGATGATGATGGAGGAAGG + Intronic
1185648529 X:1632077-1632099 GAAATAATGGACAAGGAGCATGG + Intronic
1185836874 X:3352807-3352829 GAGCTATTGATCATGGAAGAGGG + Intergenic
1185931456 X:4207868-4207890 GAGATAAAAAAGGTGGAGGAAGG + Intergenic
1185986731 X:4843216-4843238 GAGAAAAAGAACATAGAGGTGGG + Intergenic
1186059356 X:5687227-5687249 GAGAGAAGAAAGATGGAGGAAGG + Intergenic
1187162325 X:16776152-16776174 AAGATAAGAAACATGGAGCAGGG + Intergenic
1187545010 X:20241981-20242003 GAGATAAAGAATATTGAGGTAGG + Intronic
1187834868 X:23421984-23422006 GAGTTAATTAGCAGGGAGGAAGG - Intergenic
1189671918 X:43420212-43420234 GAGAGAATACACTTGGAGGAGGG + Intergenic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1190979310 X:55441865-55441887 GAGATAATGCACATGAAGAATGG + Intergenic
1190989060 X:55527067-55527089 GAGATAATGCACATGAAGAATGG - Intergenic
1191168489 X:57417837-57417859 GAGATAGAGAACCTGGGGGAAGG - Intronic
1192023823 X:67426965-67426987 GGGATAAAGCACATGGAAGAAGG - Intergenic
1192885585 X:75334420-75334442 GAGATAGTGACCATCGAGAACGG - Intergenic
1193583543 X:83293806-83293828 GGGATAAAGAACCTGGAAGATGG + Intergenic
1195118129 X:101720407-101720429 GAGATAAGGAAGGTGGAGGAGGG - Intergenic
1195629015 X:107034264-107034286 GAGAGAGAGAAAATGGAGGAGGG + Intergenic
1196259224 X:113558511-113558533 GAGAGAAGGAACATGGAAGGAGG + Intergenic
1196577378 X:117335185-117335207 GAGATATTGCAGAGGGAGGAGGG - Intergenic
1200019972 X:153195108-153195130 GACATACTGAAGATAGAGGAAGG + Intergenic
1200776267 Y:7172869-7172891 GGCATAATGGACATGGAAGAGGG - Intergenic
1200843819 Y:7811132-7811154 GAGACACATAACATGGAGGATGG + Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1201239698 Y:11946928-11946950 GAGATATTGATCATGGAAGAGGG - Intergenic
1201489944 Y:14529129-14529151 GAGAAAATGAGCCTGGATGAAGG - Intronic
1202163308 Y:21958187-21958209 GCGATAAAGAAAATGGGGGAGGG + Intergenic
1202228048 Y:22628181-22628203 GCGATAAAGAAAATGGGGGAGGG - Intergenic
1202315109 Y:23567995-23568017 GCGATAAAGAAAATGGGGGAGGG + Intergenic
1202555692 Y:26102598-26102620 GCGATAAAGAAAATGGGGGAGGG - Intergenic