ID: 1076544889

View in Genome Browser
Species Human (GRCh38)
Location 10:131238594-131238616
Sequence ACCAGAGATAATGAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544889_1076544892 14 Left 1076544889 10:131238594-131238616 CCTCCATGTTCATTATCTCTGGT 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1076544892 10:131238631-131238653 GCTGCGGTTCTTTGTGAAATAGG No data
1076544889_1076544891 -2 Left 1076544889 10:131238594-131238616 CCTCCATGTTCATTATCTCTGGT 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544889 Original CRISPR ACCAGAGATAATGAACATGG AGG (reversed) Intronic
902281776 1:15379993-15380015 TCCAGAGATGATGCAGATGGTGG - Intronic
905051006 1:35051129-35051151 AGTAGAGACAATGAAAATGGGGG - Intergenic
907628743 1:56058588-56058610 AGAAGAGAGAATGAGCATGGAGG + Intergenic
908038103 1:60077760-60077782 ATTAGAGATAATGTACCTGGAGG + Intergenic
908948761 1:69533359-69533381 TCCATAGAAAATGACCATGGGGG + Intergenic
911409500 1:97484523-97484545 CCCAGAAATGAAGAACATGGTGG - Intronic
916204224 1:162299924-162299946 CTCAGAGATAATGCACAGGGTGG - Intronic
916615395 1:166434113-166434135 AACACAGATAATGGACTTGGCGG - Intergenic
919620011 1:199853771-199853793 ACCAGAGATTATTGATATGGGGG - Intergenic
921447779 1:215266630-215266652 ACTAGAGTTAATGCACATTGGGG - Intergenic
921603052 1:217127228-217127250 AACATAGAAAATGAACATTGTGG - Intronic
923755601 1:236788462-236788484 AATGTAGATAATGAACATGGAGG - Intergenic
1062844355 10:692421-692443 CTCAGAAATAATGTACATGGGGG - Intergenic
1063039541 10:2322727-2322749 ACCAGGTATATTCAACATGGAGG - Intergenic
1064116705 10:12584357-12584379 AGGAGAGATAATGACCATGCTGG + Intronic
1064598156 10:16966859-16966881 AGGAGAGATAATTCACATGGAGG + Intronic
1067050684 10:43017551-43017573 AGCAAAAAGAATGAACATGGAGG - Intergenic
1067696537 10:48539779-48539801 ACCAGAGAAAAACAACATGAAGG - Intronic
1068756338 10:60658594-60658616 ACCAGAGATGGTGAATATGTGGG - Intronic
1069123530 10:64599813-64599835 ACCAGAAATAATAAAAATGACGG - Intergenic
1069503285 10:68973908-68973930 ACCAGAGATAATTAAGATTGAGG + Intronic
1071261141 10:83920207-83920229 ACCAGAGAGAAAGTCCATGGTGG + Intergenic
1071810602 10:89176894-89176916 AACAGAGGTAATAAAGATGGGGG - Intergenic
1072892246 10:99334221-99334243 ATAAGACATAATGAACAAGGTGG + Intronic
1073853237 10:107645412-107645434 ACCAGAGATACTGAACCTGTTGG + Intergenic
1076544889 10:131238594-131238616 ACCAGAGATAATGAACATGGAGG - Intronic
1079299720 11:19267191-19267213 AGCAGAGAGAAGGAACAAGGAGG - Intergenic
1081970610 11:47195944-47195966 ACCACAGAAGATGAACAGGGTGG + Intergenic
1086869629 11:92021355-92021377 ACCAAAGATAAATTACATGGGGG - Intergenic
1086966733 11:93035413-93035435 ACCATAGATAAGGAAGATGGAGG - Intergenic
1088732203 11:112693614-112693636 GTCAGAGATGAGGAACATGGAGG + Intergenic
1088819898 11:113448154-113448176 ACCAGAGATAATGAGCTCCGAGG + Intronic
1090159117 11:124472668-124472690 CTCAGAGATAAAGAAGATGGAGG + Intergenic
1091538314 12:1434783-1434805 ACCAGAGATACTACAAATGGTGG - Intronic
1092767495 12:11866330-11866352 ACCTGAGATAATGCAGATGTTGG - Intronic
1094740270 12:33280910-33280932 ACCAGACATGATCAAAATGGTGG + Intergenic
1095567305 12:43640510-43640532 AAGAGAGATAGAGAACATGGAGG - Intergenic
1098594329 12:72254492-72254514 AACATAGATAATGAAAATGCTGG - Intronic
1098917042 12:76268181-76268203 ATCAGAGACATTGAAGATGGTGG + Intergenic
1099317247 12:81099891-81099913 CCCAGAGATCAAGACCATGGAGG + Intronic
1099351434 12:81574499-81574521 ACCAGGGATGGTGAACATAGTGG - Intronic
1099659753 12:85541952-85541974 ACCAGAGAAATTTAACTTGGAGG - Intergenic
1102066516 12:109980653-109980675 ACCACAGTTCTTGAACATGGTGG - Intronic
1102955582 12:117056579-117056601 GCCAGAGACAATGAACACAGAGG + Intronic
1103269583 12:119662097-119662119 ACCAGGTATATTCAACATGGAGG + Intergenic
1104121498 12:125804191-125804213 AACAGACAAAATGAACTTGGAGG + Intergenic
1104300264 12:127558655-127558677 ACCAGACAGATTGAAGATGGGGG - Intergenic
1104779179 12:131408776-131408798 AACAGAGATAATTAACATCCGGG + Intergenic
1105533278 13:21240133-21240155 TCCACAGATAATGGAGATGGAGG + Intergenic
1105846631 13:24299471-24299493 ATCAGAGAGAATGGACACGGAGG + Intronic
1107349026 13:39494525-39494547 AGCAGAGTTTATGAGCATGGTGG - Intronic
1108157140 13:47596964-47596986 ACCTGAGATTATGAACACAGGGG - Intergenic
1109769274 13:66949372-66949394 AGGAGAGAAAATAAACATGGAGG + Intronic
1110218095 13:73045550-73045572 CCCAGACATAATGAGCAGGGTGG - Intergenic
1110959430 13:81602673-81602695 AATAGAGAAAATGAACTTGGAGG + Intergenic
1111522529 13:89425076-89425098 ACTAGAGTTACTGAGCATGGCGG - Intergenic
1111618798 13:90696673-90696695 AGCAGAGATAATGAATATTTGGG + Intergenic
1111878019 13:93920742-93920764 AGCAGAGAAAATTGACATGGGGG - Intronic
1112113252 13:96326012-96326034 CCTAGTGATAATGAACTTGGAGG + Intronic
1115514775 14:34174406-34174428 ACCAGAAATAATGATAATAGTGG + Intronic
1116435603 14:44892423-44892445 ACCAGAAATACTAAACATGTCGG + Intergenic
1117415007 14:55486685-55486707 ACCAGAGATACTCAACAGTGTGG + Intergenic
1117548842 14:56814004-56814026 ACCAAAGTTAATAAACTTGGAGG - Intergenic
1118482257 14:66179131-66179153 AACAGAGATACTGGATATGGTGG - Intergenic
1118613991 14:67562750-67562772 ACCAGAGAAGATGGAGATGGAGG + Exonic
1119434596 14:74589728-74589750 GCCAGTGCTAGTGAACATGGAGG + Intronic
1120897289 14:89545042-89545064 CCCAGAGATACTGAACAAGCTGG + Intronic
1121540847 14:94725162-94725184 ACCAGTGATGATGAATATGATGG - Intergenic
1123679119 15:22744872-22744894 ACTAGAGCTATAGAACATGGAGG + Intergenic
1124331338 15:28819322-28819344 ACTAGAGCTATAGAACATGGAGG + Intergenic
1127141443 15:55981832-55981854 ACCACAGGTACAGAACATGGGGG + Intronic
1127255714 15:57291051-57291073 ACCAGAGCCAAAGAAGATGGAGG - Intronic
1131960147 15:97781659-97781681 ACCATAGATAATAAACTTGTGGG + Intergenic
1136401899 16:30023865-30023887 ACCTGAGTTAATGAACACGATGG - Exonic
1137294029 16:47073142-47073164 CCCAGAGATCCTGACCATGGTGG - Intergenic
1139089103 16:63622085-63622107 ACCAGTGATAATAATGATGGTGG + Intergenic
1141346085 16:83247282-83247304 ACCAGACATAATTTACATGGAGG + Intronic
1143278280 17:5730901-5730923 ACCAGAGATGATGCACAAGGTGG - Intergenic
1144960540 17:19041889-19041911 CCCACAGATCCTGAACATGGAGG - Exonic
1144974620 17:19132635-19132657 CCCACAGATCCTGAACATGGAGG + Exonic
1147967989 17:44204322-44204344 ACCAGATGTAATGAACATGTTGG + Intergenic
1149446723 17:56718935-56718957 ACCAGAGATAAGGGAGAGGGAGG + Intergenic
1150853730 17:68730781-68730803 ACAATAGACAATGAAGATGGAGG - Intergenic
1150882788 17:69049304-69049326 CCAAGAGATAATGAACAAAGTGG - Exonic
1152284436 17:79404077-79404099 ACCATAGAAAATGAACATCCTGG - Intronic
1153294159 18:3529802-3529824 TCCCAAGATAATGAACATGAGGG - Intronic
1158237658 18:55337342-55337364 ACCAGATATAATGAAAATTTAGG + Intronic
1159099129 18:63938829-63938851 AACAGAGAGAGAGAACATGGGGG - Intergenic
1161830736 19:6602354-6602376 ACTAGATATATTGAAGATGGCGG + Intronic
1165922192 19:39306284-39306306 ACAAGAGAAAAGGAATATGGAGG - Intergenic
1166093768 19:40527079-40527101 ACCAGAGAGAAGGAACAGGAAGG - Intronic
925753849 2:7114766-7114788 AGCAGAGAAAAAGAAAATGGAGG - Intergenic
927286445 2:21362129-21362151 ACCAAACATCATGAACATGTCGG + Intergenic
928975288 2:37080582-37080604 TCCTGAGATAGAGAACATGGGGG + Intronic
931256623 2:60579871-60579893 ACCACAAATAAAGAACAAGGGGG - Intergenic
931570427 2:63663313-63663335 ACCAGAGATATTGAAGAAGTTGG - Intronic
931942304 2:67266048-67266070 ACAAGAGAAAGTGATCATGGGGG + Intergenic
932167664 2:69522885-69522907 TCAAGAGATGATCAACATGGAGG - Intronic
935504350 2:103881802-103881824 AGGAGACATAATGAAAATGGGGG + Intergenic
935943084 2:108261958-108261980 AGCAGAGAGGATGAAGATGGGGG + Intronic
938206131 2:129425432-129425454 ACCAGAGTTTCTGATCATGGCGG + Intergenic
940858464 2:158748520-158748542 GCCAGAGACAATGAACATGGAGG - Intergenic
941477925 2:165971286-165971308 ATCAGAGAAATTAAACATGGAGG + Intergenic
942049809 2:172128963-172128985 ACCAGAAATAATAAATATGTAGG - Intergenic
945769178 2:214018879-214018901 ATCAAAGATAATTAACGTGGAGG + Intronic
946984614 2:225257842-225257864 CCCAGAGATAGTGGACTTGGGGG + Intergenic
1169388467 20:5170455-5170477 ACCTGAGAGAAAGAACCTGGAGG - Intronic
1170252843 20:14304499-14304521 ACCAAAGAAAATGAGCGTGGGGG - Intronic
1170671363 20:18437100-18437122 ACCAGATATAATAAATATGAGGG + Intronic
1178482215 21:32989406-32989428 ACAAGAGAAACTCAACATGGAGG - Intergenic
1179673801 21:42968170-42968192 ACCAGAGCTACGGTACATGGGGG - Intergenic
1181407192 22:22693359-22693381 ACCAGGGACAATGAAAGTGGAGG - Intergenic
1183208227 22:36433690-36433712 ACCAGAGAAACAGAACCTGGAGG + Intergenic
1184233305 22:43169865-43169887 ACGCGAGACAATGAACATCGAGG + Intronic
1185097751 22:48821000-48821022 AACAGTGACAATGGACATGGAGG + Intronic
952489644 3:33855585-33855607 ACTAGAGCTATAGAACATGGAGG + Intronic
955191116 3:56762386-56762408 AACAGAGATAATGCAGATTGAGG + Intronic
955751129 3:62186365-62186387 ACCAGTGATAAGGAGCTTGGTGG + Intronic
956004352 3:64762662-64762684 CCCAAAGATATTGAACATAGGGG - Intergenic
956528782 3:70193525-70193547 TCCAGTGATAATCAACATAGGGG - Intergenic
957326809 3:78706287-78706309 CCCAGAGATAAGCTACATGGTGG + Intronic
959496223 3:107055573-107055595 ACCAGATATCATGAATGTGGTGG + Intergenic
960424382 3:117488185-117488207 ACCAGAGAAATTGAACAAGTTGG - Intergenic
961440708 3:126951557-126951579 ACCAGAGAGAAGGAAGAGGGAGG + Intronic
963345506 3:144092105-144092127 ACAAGAAGGAATGAACATGGTGG - Intergenic
966488077 3:180493321-180493343 ACCACAGGTCTTGAACATGGTGG + Intergenic
970434476 4:16020123-16020145 ACCAGACCTAGTGAGCATGGGGG - Intronic
971907543 4:32746507-32746529 TCCAGAGATGATGAACATTTTGG + Intergenic
977416362 4:96737869-96737891 ACCAGAAATTATGAATATGCAGG + Intergenic
979672213 4:123371825-123371847 CCCAGAGATTATGATGATGGTGG - Intergenic
980245538 4:130235276-130235298 AGGACAGATAATGAAGATGGGGG - Intergenic
981914826 4:150022478-150022500 AGCAGAGAGAATAAAGATGGTGG - Intergenic
983387477 4:167083333-167083355 GCAAGAGAGAATGCACATGGTGG - Intronic
986316813 5:6594778-6594800 ACCAGAGAGAAACACCATGGAGG - Intergenic
993014059 5:82515820-82515842 ACAAGAGATAATGCACATAAAGG + Intergenic
993309342 5:86309917-86309939 AACATAGATTATAAACATGGAGG + Intergenic
994529904 5:100956331-100956353 CCCAGAGACAATGGACTTGGGGG + Intergenic
996329028 5:122310104-122310126 ACCAGAGCTAATGAATATTTAGG + Intergenic
996445366 5:123542934-123542956 ACCAGAGAAAAAGAAGAGGGCGG - Intronic
1000536144 5:162480485-162480507 AGTAGAAATAATGAATATGGTGG + Intergenic
1001007803 5:168069712-168069734 ACCAGAGAGAAAGAAGATGAAGG - Intronic
1001278243 5:170366520-170366542 TCCAGATATAATGAACATGGGGG - Intronic
1002151425 5:177235166-177235188 ACCACAGATATTCCACATGGTGG + Intronic
1004366688 6:15019016-15019038 CCCAGAGATGCTGAACATGAGGG + Intergenic
1006567205 6:34970149-34970171 ACCAGAGTCAATGAACAGGTCGG + Exonic
1009417068 6:63427371-63427393 ACCCGAGATAATAAACATCATGG + Intergenic
1010661290 6:78573264-78573286 AAGAGAGAGAATGAAAATGGAGG + Intergenic
1011509454 6:88084162-88084184 ACCAGAGATAAGGAACCAGAAGG + Intergenic
1013123346 6:107159723-107159745 AGAAGAGATAATGAAAATAGGGG - Intronic
1014361578 6:120483223-120483245 ATGAGAGATAATAAACATGGTGG + Intergenic
1019374083 7:679869-679891 ACCAGAGATGCTGGGCATGGTGG + Intronic
1020784698 7:12558432-12558454 ACCAGGTATATTCAACATGGAGG - Intergenic
1020978885 7:15042917-15042939 AAGAGAGATAATGAAAAGGGTGG + Intergenic
1021342408 7:19480618-19480640 ACCACAGAAAATGGCCATGGGGG + Intergenic
1021514691 7:21471399-21471421 AACATAGATAATGTATATGGTGG + Intronic
1022542053 7:31146554-31146576 CCCAGAGCTAGTGAATATGGGGG - Intergenic
1025752295 7:64304299-64304321 ACTGGAGAGAATGAGCATGGGGG + Intergenic
1027544472 7:79509522-79509544 AACAGAGAGATTGAAAATGGAGG - Intergenic
1028170553 7:87590650-87590672 ACCAAAGAGAATGAACACTGTGG + Intronic
1029835018 7:103300097-103300119 ACTTCAGATAATGAATATGGAGG - Intronic
1030876910 7:114825148-114825170 GGCAGAGAAAATGAACATGAAGG + Intergenic
1038341706 8:26691800-26691822 TCCAGAGAAAATGAACATTAAGG + Intergenic
1039968683 8:42303168-42303190 AACAGAGAGAATGAGAATGGTGG + Intronic
1044061760 8:87646987-87647009 ACCAGAGACTGGGAACATGGAGG - Intergenic
1046257467 8:111720376-111720398 ACCAGAGGTCAGGAAGATGGGGG + Intergenic
1047789257 8:128185954-128185976 ACCAGTGAAAATGAACAAAGTGG - Intergenic
1048475462 8:134738711-134738733 ACCAGAGCTAATGAACGAGGAGG + Intergenic
1049293292 8:141815418-141815440 ACCAGAGATTGAAAACATGGTGG - Intergenic
1049331580 8:142056874-142056896 TCCAGAGAGGAGGAACATGGTGG - Intergenic
1050736126 9:8765381-8765403 GCCAGAGAGAATGAAGATGGCGG - Intronic
1056463180 9:86827825-86827847 ACCAGACAAAAAGTACATGGTGG - Intergenic
1056932623 9:90891457-90891479 GCCAGGGATATTCAACATGGAGG - Intronic
1059787715 9:117604348-117604370 ACCAGAGATAATGAGCCCAGTGG + Intergenic
1061479693 9:130891282-130891304 ACCTGAGATAAAGAACACGGGGG - Intergenic
1062729758 9:138102417-138102439 GTCTGAGCTAATGAACATGGAGG - Intronic
1187299903 X:18038163-18038185 ACCAGACATACTGCAAATGGAGG - Intergenic
1193867691 X:86756176-86756198 AGCAAAAAGAATGAACATGGAGG - Intronic
1196587205 X:117443737-117443759 ACCTGGGATATTGAACTTGGTGG + Intergenic
1198328443 X:135597719-135597741 ACCAGAGATAAAGCACAAAGAGG - Intergenic
1198361026 X:135895055-135895077 ACCAGAGATAAAGCACAAAGAGG - Intronic
1199799759 X:151238255-151238277 ATCAGATAAAATGAACATTGAGG - Intergenic
1199845941 X:151693412-151693434 TGCAGAGACTATGAACATGGGGG - Intergenic
1201589587 Y:15600375-15600397 AGAAGAGAAAATGAACATTGGGG + Intergenic
1201942540 Y:19475406-19475428 AGCAGAGATCATGAAGAAGGAGG + Intergenic