ID: 1076544891

View in Genome Browser
Species Human (GRCh38)
Location 10:131238615-131238637
Sequence GTGCTTGTTCAAGCTTGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544886_1076544891 13 Left 1076544886 10:131238579-131238601 CCTATTGGGAACCTTCCTCCATG 0: 1
1: 0
2: 0
3: 14
4: 94
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data
1076544887_1076544891 2 Left 1076544887 10:131238590-131238612 CCTTCCTCCATGTTCATTATCTC 0: 1
1: 0
2: 3
3: 29
4: 354
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data
1076544890_1076544891 -5 Left 1076544890 10:131238597-131238619 CCATGTTCATTATCTCTGGTGCT 0: 1
1: 0
2: 2
3: 13
4: 199
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data
1076544889_1076544891 -2 Left 1076544889 10:131238594-131238616 CCTCCATGTTCATTATCTCTGGT 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1076544891 10:131238615-131238637 GTGCTTGTTCAAGCTTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544891 Original CRISPR GTGCTTGTTCAAGCTTGCTG CGG Intronic
No off target data available for this crispr