ID: 1076544967

View in Genome Browser
Species Human (GRCh38)
Location 10:131239020-131239042
Sequence GAAAATGCACACGTGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076544967_1076544971 29 Left 1076544967 10:131239020-131239042 CCAAGTAGCACGTGTGCATTTTC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1076544971 10:131239072-131239094 CCCAAGAGAGAGCCCATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076544967 Original CRISPR GAAAATGCACACGTGCTACT TGG (reversed) Intronic
901945857 1:12702969-12702991 GAAACTGAACACGTAGTACTTGG + Intergenic
905963806 1:42071000-42071022 GTAAATGCACACTAACTACTTGG - Intergenic
907124974 1:52041650-52041672 GAACATGCACACTTCCTTCTTGG - Intronic
908757173 1:67479665-67479687 TCAAATGCACACATGCTCCTCGG - Intergenic
911514663 1:98852609-98852631 GAAAATAAACACTTGTTACTAGG + Intergenic
918076635 1:181175785-181175807 GAATATGCACACGTGATAGAGGG - Intergenic
924573579 1:245259387-245259409 TGAAATGCACACGTGTTACCAGG + Intronic
1063246807 10:4228914-4228936 GAAAATGCACACGTGGTTTGAGG - Intergenic
1063648005 10:7905069-7905091 GAAAATGCCCTCCTACTACTTGG - Intronic
1064674220 10:17745353-17745375 GAAAATGCACACGCCCTAATGGG - Intergenic
1064763137 10:18642652-18642674 GAAAATGCCCCAGAGCTACTAGG - Intronic
1070587092 10:77774662-77774684 GAAAATGCACCCATGCCACCAGG + Intergenic
1076544967 10:131239020-131239042 GAAAATGCACACGTGCTACTTGG - Intronic
1076834145 10:133012589-133012611 GAAGAGCCCCACGTGCTACTGGG - Intergenic
1078761013 11:14251881-14251903 GAAAATGCACACGTGGGAAAAGG + Intronic
1089057606 11:115599212-115599234 GAAGATGAATAGGTGCTACTAGG + Intergenic
1090974556 11:131670612-131670634 GGAAATGGACATGTGGTACTGGG + Intronic
1095707041 12:45248344-45248366 GAAAATTCAGCTGTGCTACTTGG - Intronic
1097495734 12:60330556-60330578 GAAAATGCACAAGAGTTTCTTGG - Intergenic
1105955471 13:25278295-25278317 TAAAATGCACAACTGCTACCGGG + Intronic
1107342125 13:39418670-39418692 GAAAATGCACAACCGCTATTGGG - Intronic
1110273908 13:73621294-73621316 GAAATTGCACACAGGGTACTGGG - Intergenic
1120358615 14:83465635-83465657 GACAAGGCACACATACTACTCGG + Intergenic
1121283211 14:92714424-92714446 GTAAATGAACACGTGATCCTGGG + Exonic
1137897333 16:52228229-52228251 AAGAATGCACACGTGTTTCTTGG + Intergenic
1142502025 17:338594-338616 GAAAATGCCCAAGTGCTCCCAGG + Intronic
1152828984 17:82485852-82485874 GAGAATGCCCACATGCTACATGG - Intronic
1155065399 18:22265003-22265025 GAAAATCCACACGTGGTGCTGGG - Intergenic
1162239582 19:9338842-9338864 GAGAATGCACATGTGCTTCTCGG + Intronic
1164435317 19:28223591-28223613 CAAAATGCACCCCTGCTACCGGG - Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
928065809 2:28163470-28163492 GAAAATGTACACATGGTGCTGGG + Intronic
931261537 2:60623906-60623928 GAATAAGTACAAGTGCTACTAGG - Intergenic
935066092 2:99649877-99649899 GGCAATGCACACCTGCAACTAGG + Intronic
935438924 2:103068869-103068891 TAAAATGCCCACGTGCTTCCTGG - Intergenic
938236021 2:129707971-129707993 GAAAATGCCCATGTGGCACTAGG - Intergenic
1172508060 20:35478948-35478970 GAAGATGCACACATAATACTGGG - Intronic
1173421863 20:42908277-42908299 AAAAATTCAGACGTGCTTCTGGG - Intronic
1174802590 20:53576620-53576642 CAAAATGGACAGGTGATACTTGG + Exonic
1174951635 20:55048393-55048415 GAAAATGCACACTTTCTGCCAGG + Intergenic
1175363270 20:58431878-58431900 GAAAAAGGAGACGTGCTGCTTGG + Intronic
1177397632 21:20557914-20557936 GACAATAAACAGGTGCTACTGGG + Intergenic
952091364 3:29890623-29890645 GAAAATGCTCACGTCATATTAGG + Intronic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
961420364 3:126798166-126798188 GACAAGGCACACGGGCCACTCGG + Intronic
966188580 3:177250033-177250055 GTAAAAGCACAGGTGCTATTAGG + Intergenic
966249685 3:177850009-177850031 GGAAAGGCCCACGTGCCACTGGG - Intergenic
973028732 4:45308795-45308817 AAAAATGGTCAAGTGCTACTTGG - Intergenic
974955252 4:68631497-68631519 AAAAATACACAGCTGCTACTCGG - Intronic
977246225 4:94634811-94634833 AAAAATTCACACGTACTACCGGG + Intronic
982223816 4:153147370-153147392 TGAAATGTACACTTGCTACTGGG + Intergenic
987982417 5:25103351-25103373 CAAAATGAACACATGCTATTGGG + Intergenic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
995440518 5:112186808-112186830 CAAAAAACACAGGTGCTACTTGG + Intronic
996944348 5:129048605-129048627 GAAAATGCACACTTGATCATTGG - Intergenic
998735303 5:145131510-145131532 TAAAATGCCCACGTGCAACCTGG + Intergenic
1014750770 6:125253405-125253427 GAAGATGCCCATGGGCTACTGGG + Intronic
1015776855 6:136823030-136823052 GAACAAGGACACGGGCTACTAGG - Intronic
1024739857 7:52341933-52341955 GGAGGTGCACACCTGCTACTCGG - Intergenic
1024880660 7:54082197-54082219 GAAAGTGGACACCTGCTACCGGG + Intergenic
1031508193 7:122613958-122613980 GAAAATGTACACCTCCCACTGGG + Intronic
1037161661 8:15780657-15780679 GAAAGTGCCCAGGTCCTACTCGG - Intergenic
1038235467 8:25748838-25748860 GAAAATGGGCATGTGCAACTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1188036876 X:25328605-25328627 GGAAATGCATAGGTGCTACTTGG + Intergenic
1188832797 X:34920951-34920973 GAAAATGTACTCATTCTACTTGG + Intergenic
1188860320 X:35247870-35247892 AATAATGCAGACCTGCTACTGGG + Intergenic
1189211408 X:39287093-39287115 AAAAATGCACACATGTAACTTGG - Intergenic
1190598307 X:52067274-52067296 GAGAAAGCACAGGCGCTACTAGG + Exonic
1190610517 X:52186799-52186821 GAGAAAGCACAGGCGCTACTAGG - Exonic
1198801737 X:140454673-140454695 GAGAAAGCACACGAGCTACATGG + Intergenic
1200957080 Y:8960551-8960573 GAAAATAGACACGTGCCACTGGG - Intergenic