ID: 1076545670

View in Genome Browser
Species Human (GRCh38)
Location 10:131244464-131244486
Sequence AATCTTAGCCAGCTGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545670_1076545673 25 Left 1076545670 10:131244464-131244486 CCTCTCAGCAGCTGGCTAAGATT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1076545673 10:131244512-131244534 CAAGAAGTGTGATGCCCCCATGG No data
1076545670_1076545672 -7 Left 1076545670 10:131244464-131244486 CCTCTCAGCAGCTGGCTAAGATT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1076545672 10:131244480-131244502 TAAGATTCTTTAAGGTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545670 Original CRISPR AATCTTAGCCAGCTGCTGAG AGG (reversed) Intronic
902519701 1:17009204-17009226 CATCTGAGCCTGATGCTGAGGGG - Intronic
902713536 1:18256732-18256754 AAATATAGCCAGATGCTGAGAGG - Intronic
903852126 1:26314107-26314129 AATCTTGTCCTGCTGCTCAGAGG + Intronic
904018813 1:27445599-27445621 AATTTTAGCCAGATGCTCAGGGG + Intronic
907498565 1:54861572-54861594 AATCTAAGCCAGCTATGGAGGGG - Intronic
908172778 1:61524052-61524074 AATCTTCCCCAGAGGCTGAGAGG - Intergenic
909212983 1:72847846-72847868 GCTCTGAGCCAGCTGCAGAGAGG - Intergenic
912378860 1:109235623-109235645 AATGTTACACAGCTGGTGAGTGG - Intronic
912728803 1:112082988-112083010 TATCTTGGCCAGCAGCTGTGGGG + Intergenic
916048936 1:161021326-161021348 AATCTGAGGCAGCTCCTGTGGGG - Exonic
918500478 1:185189351-185189373 AATGTTAATCAGCTGCTGACAGG - Intronic
920851463 1:209630825-209630847 GATCTAAGCCAGATCCTGAGTGG - Intronic
921505435 1:215963265-215963287 AATGTCACCCAGCTGCTGATGGG + Intronic
923140788 1:231160826-231160848 AGCCTAAGCGAGCTGCTGAGTGG + Intergenic
1063869422 10:10401800-10401822 AATCATGGCCAGCAGCTGTGGGG - Intergenic
1064550663 10:16497778-16497800 GATCTTATCCATATGCTGAGGGG - Intronic
1071386308 10:85124719-85124741 CCTATCAGCCAGCTGCTGAGAGG - Intergenic
1076203357 10:128575553-128575575 AATCACAGCCAGCTGCTGATTGG - Intergenic
1076545670 10:131244464-131244486 AATCTTAGCCAGCTGCTGAGAGG - Intronic
1081114857 11:39187784-39187806 AAAATTAGCCAGATGCTGTGAGG + Intergenic
1081136929 11:39450368-39450390 AATCTTTGGCAGCTTCTGTGTGG - Intergenic
1083471278 11:62885717-62885739 ATTCTTAGTCAGTAGCTGAGTGG + Intronic
1087956535 11:104294987-104295009 TATCTCAGCCAGCTGCTTTGGGG + Intergenic
1092425451 12:8371939-8371961 AATGTTAGCCCCCTGCTGTGGGG - Intergenic
1092883128 12:12903429-12903451 AAAATTAGCCAGGTGCGGAGGGG - Intronic
1095257030 12:40050807-40050829 AAACTTAACCAGCTGATAAGTGG - Intronic
1097673298 12:62568061-62568083 AAACTAAGTCAACTGCTGAGGGG + Intronic
1101596943 12:106176210-106176232 AAACTCACACAGCTGCTGAGTGG + Intergenic
1103286620 12:119807061-119807083 AATTCTAACCAGCTCCTGAGTGG - Intronic
1103895586 12:124270974-124270996 AATATTTGCCAGGTGGTGAGGGG - Intronic
1104088867 12:125497820-125497842 ACTCCTGGCCACCTGCTGAGCGG - Intronic
1104590197 12:130078337-130078359 AATCTGAGCCAGCTTGTGATTGG + Intergenic
1105034444 12:132908623-132908645 AATTTTAGCCAACGGCTGCGTGG + Intronic
1106184852 13:27400360-27400382 AAACTTACCCAGGTGTTGAGAGG + Intergenic
1110013447 13:70368082-70368104 AATGATGGCCAGGTGCTGAGTGG + Intergenic
1111762713 13:92485655-92485677 AATCTTACCCACCTGCTGTAAGG - Intronic
1112161016 13:96868028-96868050 AATCATAGCCAGGTACAGAGTGG + Intergenic
1112759439 13:102677392-102677414 CATCTTTTCCAGCTGCTGTGTGG - Intronic
1112791377 13:103006168-103006190 AATCCCAGCCAGTAGCTGAGGGG - Intergenic
1115488414 14:33935696-33935718 ACTTTGAGACAGCTGCTGAGTGG + Intronic
1116248029 14:42442912-42442934 AATCTTAATTAGCTGGTGAGAGG - Intergenic
1118016495 14:61666547-61666569 ACTCTGTGCCAGGTGCTGAGTGG + Intergenic
1119359711 14:74038193-74038215 AATCTTTGCTAAATGCTGAGCGG + Intronic
1120688729 14:87568667-87568689 AATCTTTCCCAGCTGAAGAGAGG + Intergenic
1121794146 14:96721791-96721813 AATCCCAGCCAGCTACTGAAGGG + Intergenic
1123961261 15:25403277-25403299 AAACTTAGGAAGCTACTGAGGGG - Intronic
1127505268 15:59591905-59591927 AATCTTGGCCACATTCTGAGTGG - Intergenic
1128350120 15:66882804-66882826 CATCTTGGCCAGTTGCTGTGTGG + Intergenic
1129417572 15:75395411-75395433 AATCTGTGCCAGCTCTTGAGGGG + Intronic
1129417579 15:75395457-75395479 AATCTGTGCCAGCTCTTGAGGGG + Intronic
1131439982 15:92452418-92452440 GATCATGGCCAGCTGCTCAGTGG - Intronic
1132356775 15:101177457-101177479 CATCTCAGCCAGCTGCTGGGTGG + Exonic
1135283050 16:21169847-21169869 TATCTTAGGCAGCTGTGGAGAGG - Intronic
1137429013 16:48403329-48403351 AACCTTTGCCATCTGCTGTGGGG - Intronic
1140276468 16:73513252-73513274 AATAATATCCAGCTACTGAGTGG - Intergenic
1148997250 17:51721675-51721697 AATCCTATCCATCTGGTGAGGGG + Intronic
1154168549 18:12034448-12034470 AAGTTTACCCGGCTGCTGAGTGG - Intergenic
1155457880 18:26040320-26040342 AATGTTAAGCAGCTCCTGAGAGG + Intronic
1158031928 18:52976483-52976505 AACCTTAGCTAGCTACTGAAAGG + Intronic
1158346829 18:56524433-56524455 GATCTTGGGCAGCTGCTGATAGG - Intergenic
1158464901 18:57681377-57681399 GATTTTAGTCAGATGCTGAGCGG + Intronic
1158510199 18:58083730-58083752 AATGTTCGTCAGCTGATGAGTGG + Intronic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
1162705066 19:12549586-12549608 AATCTTAGGCTGTTACTGAGAGG - Intronic
1165232060 19:34393419-34393441 TATCCCAGCCAGCTGCAGAGAGG - Intronic
925811971 2:7709940-7709962 AACCTTAGCCTCCTGCTGAATGG - Intergenic
926334590 2:11853718-11853740 CATCTTACCTAGATGCTGAGAGG + Intergenic
929916111 2:46137205-46137227 AACCTTATCCAGCTGGTAAGTGG + Intronic
932109858 2:68988158-68988180 AATTGTAGCCAGCTGGTCAGAGG + Intergenic
932196207 2:69786191-69786213 AATGATACCCAGCTGCTCAGGGG + Intronic
941684411 2:168433694-168433716 GATCTCAGCCAGCAGCAGAGAGG + Intergenic
945050070 2:205815326-205815348 CATCTGTGCCAGCTGATGAGAGG + Intergenic
945779803 2:214155173-214155195 ACTCTTAGCCAGCTGAAGACTGG - Intronic
946804330 2:223455595-223455617 AATCTTAGCCAGATGTGGTGTGG + Intergenic
947149788 2:227103753-227103775 AAGTTTACCCAGCTGCTGAGTGG - Intronic
1179200869 21:39219268-39219290 AAACTTAGCCAGCTGTGGTGGGG + Intronic
1183060927 22:35335950-35335972 CATCTTTCCCAGCTGCTGTGCGG - Intronic
1184487162 22:44786697-44786719 AATCTTGCCCAGCTGCAGTGAGG - Intronic
950146878 3:10656413-10656435 ATTCTCAGCCAGTTCCTGAGGGG - Intronic
954414482 3:50386411-50386433 AATTACAGCCCGCTGCTGAGGGG + Intronic
954439230 3:50512455-50512477 AATCTAAGCTGGCTGCTGTGGGG + Intergenic
955028407 3:55192257-55192279 AGTATTAACCAACTGCTGAGTGG - Intergenic
956058760 3:65328789-65328811 AAGCTTACCCAGCTGAAGAGAGG + Intergenic
960120135 3:113940790-113940812 AATCTTATGCAGCTGTTAAGGGG - Intronic
961602948 3:128075223-128075245 GATCTTAGCCAAAGGCTGAGAGG + Intronic
963912535 3:150826923-150826945 CATGGGAGCCAGCTGCTGAGAGG - Intergenic
969889099 4:10243219-10243241 AAGCTTTGCCAGCTTCTGTGGGG + Intergenic
971009396 4:22416442-22416464 AGTGTTAACCAGCTGCTAAGTGG - Intronic
971454271 4:26829438-26829460 GAGCTTAGCCAGTTGCTAAGTGG - Intergenic
973826027 4:54708436-54708458 AGTCTTATCCAGGAGCTGAGCGG + Intronic
974515438 4:62902177-62902199 AATCTCAGCCATCTTTTGAGGGG - Intergenic
974896396 4:67944871-67944893 AATCTTAGAGAGCTGGTGTGGGG - Intronic
978342501 4:107733579-107733601 AATCTTACCCAGCAGCTGCTGGG - Intergenic
979685298 4:123505461-123505483 AATTTCAGCCTGCTGCTAAGGGG - Intergenic
980997572 4:139794806-139794828 AATCTTGGCCAGCTCCACAGAGG - Intronic
981164117 4:141536878-141536900 AAAATTAGCCAGCTACTCAGGGG - Intergenic
989765404 5:45076708-45076730 AAACCAAGCCAGCTCCTGAGTGG - Intergenic
992507551 5:77402806-77402828 AAGATTACACAGCTGCTGAGTGG + Intronic
994715601 5:103318291-103318313 TATTTTAGCCAGCTACAGAGTGG + Intergenic
1001320272 5:170674991-170675013 AATTTTAGACAGATGCTGAAAGG - Intronic
1003112770 6:3263261-3263283 CCTCTGAGCCAGCTGCTGTGGGG + Intronic
1003481568 6:6538430-6538452 GAACTTAGCAAGATGCTGAGGGG - Intergenic
1004535618 6:16498154-16498176 AGTCTTTGCCAGGGGCTGAGAGG - Intronic
1005654203 6:27916169-27916191 AATTTTAGAAAGCTGCTGAGGGG + Intergenic
1006949082 6:37806531-37806553 AAACCTTGCCAGGTGCTGAGAGG - Intergenic
1018716624 6:166538077-166538099 CATCTTAGGCACCTGCTGGGTGG + Intronic
1020003474 7:4768816-4768838 AGTCTGTGCCAGCTGCTGGGAGG + Exonic
1020917162 7:14209086-14209108 AATTATAGCTAGATGCTGAGTGG + Intronic
1020984566 7:15117039-15117061 AATATCAGTCAGCTGGTGAGTGG + Intergenic
1022273844 7:28837293-28837315 AATCCCAGTGAGCTGCTGAGCGG - Intergenic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1031580592 7:123469959-123469981 AATCTTAGCCAGCATCAGGGAGG - Intronic
1033447670 7:141436732-141436754 AAGCCAAGCCAGATGCTGAGTGG + Intronic
1036245264 8:7110772-7110794 AATATTAGCCCCCTGCTGTGGGG + Intergenic
1036815726 8:11901622-11901644 AAACTGAGCCAGGTCCTGAGAGG + Intergenic
1044423732 8:92027687-92027709 ATTCTGGGCCAGCTGCTGACTGG - Intronic
1045418677 8:101992556-101992578 AAGTTTAGCCAGCTGGTAAGTGG - Intronic
1045720214 8:105101038-105101060 AATCTTAGCCACCTGCCCATGGG + Intronic
1047297569 8:123584695-123584717 AACCTTAGACAGATGATGAGGGG - Intergenic
1047742808 8:127820381-127820403 AATGTTGCCCAGCTGTTGAGTGG + Intergenic
1048744882 8:137603212-137603234 AATCTGAGCCAGCTTCTTGGAGG + Intergenic
1050001608 9:1083506-1083528 ATTCTCAGCCCGATGCTGAGTGG - Intergenic
1050410849 9:5363361-5363383 AATATAAGCCAGTGGCTGAGTGG - Intronic
1051510306 9:17870265-17870287 AATCTCTGCCAGCAGCTGAGAGG - Intergenic
1053020306 9:34689875-34689897 AATCTTAGACAGGAGCTCAGAGG + Intronic
1058275624 9:103038014-103038036 GAACTTAGCCTGCTGCTAAGTGG + Intergenic
1059922706 9:119176606-119176628 CATCTTAGGCAGCTGGTGAGAGG + Intronic
1059955387 9:119510471-119510493 AATCCTAGCCACCTTCTGGGAGG + Intronic
1061299391 9:129696150-129696172 AGTCTTAGCCAGTTGGTGAGTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062110235 9:134778267-134778289 CAGCTGGGCCAGCTGCTGAGAGG - Intronic
1185863939 X:3605817-3605839 AATCTTACCCCACTGCTGGGGGG + Exonic
1186390837 X:9157461-9157483 AACCTTAGCTAGTTGCTCAGTGG + Intronic
1186604492 X:11076428-11076450 CATCTTATCCAGCTGCTGCTTGG - Intergenic
1190520500 X:51274676-51274698 AATATTAACCAGTTGCTGATTGG + Intergenic
1195903239 X:109819842-109819864 AATCTTCTCCAGCTAGTGAGTGG - Intergenic
1196155663 X:112426402-112426424 AATCATAGCAAGCTGTTTAGTGG - Intergenic
1197151700 X:123227435-123227457 AATGTTACCTAGCTGATGAGTGG + Intronic
1197235563 X:124058769-124058791 AATGTTAGCCAGATTTTGAGAGG + Intronic
1199889572 X:152063076-152063098 AAAGTTAACCAGGTGCTGAGTGG - Intergenic
1200800225 Y:7380116-7380138 AATCTTACCCCACTGCTGGGGGG - Intergenic
1200809043 Y:7463276-7463298 GATCTCAGCCAGGTGCTGGGAGG - Intergenic