ID: 1076545891

View in Genome Browser
Species Human (GRCh38)
Location 10:131245646-131245668
Sequence TTCTGGGCTGTCGCCACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545891_1076545899 0 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545899 10:131245669-131245691 CAGGCAGGGACCTTCCCGAGGGG No data
1076545891_1076545903 20 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data
1076545891_1076545898 -1 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545898 10:131245668-131245690 ACAGGCAGGGACCTTCCCGAGGG No data
1076545891_1076545905 26 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data
1076545891_1076545897 -2 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545897 10:131245667-131245689 AACAGGCAGGGACCTTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545891 Original CRISPR TTCTGGGCTGTCGCCACTGA AGG (reversed) Intronic