ID: 1076545895

View in Genome Browser
Species Human (GRCh38)
Location 10:131245662-131245684
Sequence GGAAGGTCCCTGCCTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545895_1076545905 10 Left 1076545895 10:131245662-131245684 CCCAGAACAGGCAGGGACCTTCC No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data
1076545895_1076545903 4 Left 1076545895 10:131245662-131245684 CCCAGAACAGGCAGGGACCTTCC No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545895 Original CRISPR GGAAGGTCCCTGCCTGTTCT GGG (reversed) Intronic