ID: 1076545896

View in Genome Browser
Species Human (GRCh38)
Location 10:131245663-131245685
Sequence GGGAAGGTCCCTGCCTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545896_1076545903 3 Left 1076545896 10:131245663-131245685 CCAGAACAGGCAGGGACCTTCCC No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data
1076545896_1076545905 9 Left 1076545896 10:131245663-131245685 CCAGAACAGGCAGGGACCTTCCC No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545896 Original CRISPR GGGAAGGTCCCTGCCTGTTC TGG (reversed) Intronic