ID: 1076545903

View in Genome Browser
Species Human (GRCh38)
Location 10:131245689-131245711
Sequence GGGCTCCTGCCACTGCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545895_1076545903 4 Left 1076545895 10:131245662-131245684 CCCAGAACAGGCAGGGACCTTCC No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data
1076545891_1076545903 20 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data
1076545896_1076545903 3 Left 1076545896 10:131245663-131245685 CCAGAACAGGCAGGGACCTTCCC No data
Right 1076545903 10:131245689-131245711 GGGCTCCTGCCACTGCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545903 Original CRISPR GGGCTCCTGCCACTGCTCCT CGG Intronic