ID: 1076545905

View in Genome Browser
Species Human (GRCh38)
Location 10:131245695-131245717
Sequence CTGCCACTGCTCCTCGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076545896_1076545905 9 Left 1076545896 10:131245663-131245685 CCAGAACAGGCAGGGACCTTCCC No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data
1076545900_1076545905 -7 Left 1076545900 10:131245679-131245701 CCTTCCCGAGGGGCTCCTGCCAC No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data
1076545891_1076545905 26 Left 1076545891 10:131245646-131245668 CCTTCAGTGGCGACAGCCCAGAA No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data
1076545895_1076545905 10 Left 1076545895 10:131245662-131245684 CCCAGAACAGGCAGGGACCTTCC No data
Right 1076545905 10:131245695-131245717 CTGCCACTGCTCCTCGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076545905 Original CRISPR CTGCCACTGCTCCTCGGTAC AGG Intronic