ID: 1076548211

View in Genome Browser
Species Human (GRCh38)
Location 10:131260246-131260268
Sequence GCTCCGAGCCTACCTGAGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076548209_1076548211 -6 Left 1076548209 10:131260229-131260251 CCAGGCGTCGGGACGGCGCTCCG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1076548201_1076548211 27 Left 1076548201 10:131260196-131260218 CCAGGAAGCCTCCGCGCGCTCGC 0: 1
1: 0
2: 2
3: 5
4: 87
Right 1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1076548204_1076548211 16 Left 1076548204 10:131260207-131260229 CCGCGCGCTCGCTAAGGCAGCAC 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1076548203_1076548211 19 Left 1076548203 10:131260204-131260226 CCTCCGCGCGCTCGCTAAGGCAG 0: 1
1: 0
2: 1
3: 4
4: 27
Right 1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076548211 Original CRISPR GCTCCGAGCCTACCTGAGAC GGG Exonic
901068084 1:6504142-6504164 GCTTCCTGCCTACCTGAGGCAGG - Intronic
901627893 1:10634139-10634161 GCCCGGAGCCTCCCTGAGGCTGG - Intergenic
902886110 1:19406020-19406042 GCACAGAGCCTGCCTGAGAGAGG - Intronic
903801416 1:25971270-25971292 GCTCAGAGCCTAGCTGGGACGGG + Intronic
903947091 1:26970864-26970886 GCTGGGAGCTTAGCTGAGACTGG + Intergenic
905000548 1:34664867-34664889 GCTCCAAGCCTATCTGTGTCGGG + Intergenic
909585230 1:77281908-77281930 GCTCCGCGCCTCCCCGAGCCGGG - Intergenic
915728788 1:158037977-158037999 GCCCCGAGTCTAGCTGACACTGG - Intronic
920313294 1:205061067-205061089 GCTCCGAGCCTACCTGGGAGAGG + Intronic
1067015927 10:42756209-42756231 ACTCCCACCCTACCTTAGACAGG + Intergenic
1072811749 10:98467716-98467738 TCTCCCGGCCTTCCTGAGACTGG - Intronic
1076062019 10:127420361-127420383 TCTCAGAGCCTTCCTGAGCCTGG + Intronic
1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG + Exonic
1076806446 10:132861542-132861564 GCTCAGAGCCTCCCAGAGCCAGG + Intronic
1079032725 11:16997601-16997623 GCTCAGAGGCTAGCTGAGGCAGG - Intronic
1083233097 11:61335543-61335565 TCTCAGAGCCTACCAGGGACTGG - Intronic
1086310559 11:85531633-85531655 GCTCTGAGCCTATCTTTGACAGG + Intronic
1090275095 11:125413441-125413463 GCTCCCAGCCTACCTGTGGGAGG + Intronic
1093717152 12:22396307-22396329 TCTCCATGCCCACCTGAGACTGG - Intronic
1099293198 12:80798114-80798136 GCTCCCAGCCTAGCAGAGAGAGG - Intronic
1101326538 12:103720737-103720759 GCACAGAGGATACCTGAGACTGG + Intronic
1102311268 12:111846341-111846363 GCTGCCAGACTACCTGAGAGTGG + Intronic
1104921697 12:132293981-132294003 CCTCCGAGCCTATCTGTGAATGG + Intronic
1114187409 14:20413358-20413380 GCTCGGACCCTACCTTAGACTGG + Intronic
1128222856 15:65981357-65981379 GCTGGGAGCCTTCCTGAGCCTGG - Intronic
1134328444 16:13228504-13228526 GCTCAGAGCAGACCTCAGACTGG + Intronic
1134673908 16:16075975-16075997 GCCCCGAACCTGCCTGAGAAGGG + Intronic
1136687338 16:32003052-32003074 GCTCCGACCCTGCCTGGGGCGGG - Intergenic
1141513059 16:84525083-84525105 GCTCCCAGCCAATGTGAGACAGG + Intronic
1142281280 16:89149132-89149154 CCTCCGAGTCTACCTCAGCCTGG + Intronic
1144944177 17:18961402-18961424 CCTCCGAGCCTCCCTGTGCCTGG + Intronic
1146058206 17:29591522-29591544 GCTCAGAGACTACCTGGGAGTGG + Intronic
1148231082 17:45935409-45935431 GCTGCGTGCCTACCTCTGACTGG - Intronic
1151293322 17:73165715-73165737 GATCCGAGCCTGCCAGAGGCAGG + Intronic
1151572856 17:74935931-74935953 GCTCCGGGCTTACCTGAGGCCGG - Intronic
1153564689 18:6407919-6407941 GCTCCAAGCCTCCTTGAGACTGG - Intronic
1157308941 18:46537489-46537511 GCTCAGATCCTGCCTGAGAGGGG - Intronic
1158923367 18:62221080-62221102 CCTCCGAGCCAACCTGACAAAGG + Exonic
1160197078 18:76764537-76764559 GGCCAGAGCCTCCCTGAGACAGG + Intergenic
1160241233 18:77124575-77124597 CCTCCGAACTCACCTGAGACAGG - Intronic
1165982327 19:39735189-39735211 GCTCCCACCCTACCTCAGTCAGG + Intronic
1167756757 19:51417595-51417617 GCGCAGGGCCTGCCTGAGACAGG + Exonic
928317344 2:30256380-30256402 GTTCCCAGCCTGCCTGTGACTGG + Intronic
931385715 2:61795828-61795850 GCCCCTAGTCTCCCTGAGACTGG + Intergenic
932643227 2:73472854-73472876 GCTCAGAGCTTTCCTGGGACTGG + Intronic
943767616 2:191678847-191678869 GATCGGATCCTACCTGAGGCGGG + Intronic
1169907088 20:10615206-10615228 GATCCAAGCCTACCTGAGATGGG - Intronic
1171099489 20:22369441-22369463 ACTCCGGGCCTGCCTAAGACAGG + Intergenic
1172684685 20:36745077-36745099 GCTCCTAGTCTACCTGTGATAGG + Intronic
1175795851 20:61770221-61770243 GCTCCCAGCCTTCCTTAGAAAGG - Intronic
1183086908 22:35492071-35492093 GCAGGGAGCATACCTGAGACTGG - Intergenic
1184176382 22:42791870-42791892 GCCCCCAGCCTGGCTGAGACGGG - Intergenic
952954692 3:38549674-38549696 GCTCCCAGCCTAAGGGAGACAGG - Exonic
959507286 3:107170418-107170440 GCTGTGATACTACCTGAGACTGG - Intergenic
961325955 3:126109474-126109496 GCTCAGACCCTACCAGATACAGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
969179835 4:5431007-5431029 ACACAGAGCCTACCTAAGACAGG - Intronic
969880250 4:10167394-10167416 GCTCCCAGCAGAGCTGAGACTGG - Intergenic
972630471 4:40837382-40837404 GCTCCCAGCCTGTCTGAGATGGG - Intronic
976782552 4:88777196-88777218 TCTCCCAGCCTACCTGACACCGG - Intronic
985639726 5:1058022-1058044 GCCCCAAGCCTCCCTGAGACGGG - Intronic
986042638 5:4008382-4008404 GCTCAGAGCACTCCTGAGACTGG + Intergenic
986972613 5:13354742-13354764 GCTCCGAGCTTTCTGGAGACTGG - Intergenic
991489400 5:67167157-67167179 GCTCGGAGCCTCATTGAGACAGG + Exonic
1002430361 5:179199711-179199733 CCTCCCAGCCTCCCTGAGTCTGG + Intronic
1008804258 6:55408508-55408530 GCTATGAGGATACCTGAGACTGG - Intergenic
1016423857 6:143913403-143913425 GGGCGGAGCCTGCCTGAGACAGG - Intronic
1031221250 7:118968366-118968388 GCTCCAAGCCTACCTAAGGAAGG - Intergenic
1031265177 7:119572354-119572376 GCTCCCACCCTAGCTCAGACAGG - Intergenic
1034067893 7:148154230-148154252 ACTCAGAGACTACCTGAGAGTGG + Intronic
1034274855 7:149819594-149819616 GCACCCAGCCTACCTGAGTGTGG + Intergenic
1034570374 7:151951025-151951047 CCTCTGAGCCTACCTGAAATTGG - Intergenic
1040840723 8:51781651-51781673 GCTCCTACCCTGCCAGAGACAGG + Intronic
1049451447 8:142664261-142664283 GCCCCGACCCCACCTGAGGCAGG - Intronic
1049521263 8:143092604-143092626 GCTCCGAGCACACCTGGGTCTGG - Intergenic
1049735028 8:144200247-144200269 GCTCCAACCCTGCCTTAGACAGG + Intronic
1057872542 9:98729188-98729210 GCTCTGAGCCACGCTGAGACAGG + Intergenic
1059496906 9:114717589-114717611 GCTCCTGGGCTGCCTGAGACAGG + Intergenic
1061640920 9:131954429-131954451 TCTAGGAGTCTACCTGAGACAGG + Intronic
1187621762 X:21063458-21063480 GCTCTGAGCCTAGCTGAGGGAGG - Intergenic
1190064215 X:47229392-47229414 GCTCCCAGCCTTTCAGAGACAGG + Exonic
1200757005 Y:6999545-6999567 TTTCCAAGCCTACCTGAGATGGG + Intronic