ID: 1076548659

View in Genome Browser
Species Human (GRCh38)
Location 10:131263050-131263072
Sequence CAGTTTAGAAGCACAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076548658_1076548659 -4 Left 1076548658 10:131263031-131263053 CCATTATCAGGATGTGTCACAGT 0: 1
1: 0
2: 9
3: 85
4: 487
Right 1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076548659 Original CRISPR CAGTTTAGAAGCACAATTGT TGG Intronic
No off target data available for this crispr