ID: 1076550182

View in Genome Browser
Species Human (GRCh38)
Location 10:131273127-131273149
Sequence CAGGGTAATGGAAGGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076550182_1076550205 27 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550205 10:131273177-131273199 AATGGGTCCTGGACTCCCAGGGG No data
1076550182_1076550203 25 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550203 10:131273175-131273197 GCAATGGGTCCTGGACTCCCAGG No data
1076550182_1076550196 10 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550196 10:131273160-131273182 GGTCCCTGCCCCATGGCAATGGG No data
1076550182_1076550194 3 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550194 10:131273153-131273175 TAGGTCGGGTCCCTGCCCCATGG No data
1076550182_1076550195 9 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550195 10:131273159-131273181 GGGTCCCTGCCCCATGGCAATGG No data
1076550182_1076550204 26 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550204 10:131273176-131273198 CAATGGGTCCTGGACTCCCAGGG No data
1076550182_1076550199 16 Left 1076550182 10:131273127-131273149 CCCGCATCCCTTCCATTACCCTG 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1076550199 10:131273166-131273188 TGCCCCATGGCAATGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076550182 Original CRISPR CAGGGTAATGGAAGGGATGC GGG (reversed) Intronic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900704399 1:4070995-4071017 CAGGATTCTGGAAGGGATCCTGG - Intergenic
901221250 1:7585259-7585281 CAGAGTAAAGGAAGGGGTACGGG + Intronic
903139723 1:21332249-21332271 GATGGGACTGGAAGGGATGCAGG - Intronic
904043703 1:27598421-27598443 CTGGCCAATGGAAGAGATGCTGG + Intronic
904082804 1:27882584-27882606 CAGGGAAGTGGAAGGGCAGCAGG - Exonic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906138633 1:43519534-43519556 CAGGGGAAAGGAAGGAATCCAGG + Intergenic
906247510 1:44287374-44287396 AAGGGTAATGGAGGGAAGGCCGG - Intronic
907248054 1:53120571-53120593 CAGGGTTGGGGAAGGGATGGTGG - Intronic
907337110 1:53707111-53707133 AAGGGGACTGGAAGGGATGAGGG - Intronic
908350779 1:63285205-63285227 CAGGAGAATGGAAGGAATCCAGG - Intergenic
909519303 1:76548493-76548515 CTGGGGCATGGAAGTGATGCTGG - Intronic
909612030 1:77561502-77561524 CAAGGTAATGGAAAGGACACTGG - Intergenic
910452147 1:87358249-87358271 CAGGGTTCTGGAAAGGATGTGGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915244701 1:154548172-154548194 CAGGGCAGTGGAAGGGTGGCTGG - Intergenic
915826861 1:159087284-159087306 CAGGGTGATGGTAAGGATGATGG + Intronic
916573988 1:166051089-166051111 CAGGGGCATGGAAGGGCTGAGGG - Intergenic
918013562 1:180610582-180610604 CAGGCTAATGGTAGGAATGTTGG + Intergenic
919086626 1:192928543-192928565 CAGGGCAACGGAAGGGAGGTTGG + Intergenic
920500493 1:206482165-206482187 CGGGGGAAAGGAGGGGATGCTGG + Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921374555 1:214460367-214460389 AAGGGTCATGGAAGGGAAGGAGG - Intronic
923646639 1:235828263-235828285 TAGGGGAATGGAAGGGATAGGGG + Intronic
924855144 1:247868375-247868397 CAGGGTTATTGAAGAGATGGGGG + Intronic
1063105137 10:2986084-2986106 CGGGGAAAAGGAAGGGGTGCAGG - Intergenic
1063647990 10:7904949-7904971 CAGTGTGAGGGAAAGGATGCAGG - Intronic
1063908966 10:10810630-10810652 CAGGGGAGTGGAAGGGAAGATGG + Intergenic
1064340112 10:14477943-14477965 CAGGGGAAGGGAGGGGATGGAGG + Intergenic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065225176 10:23536238-23536260 CAGGGCAGTGGCAGGGATTCTGG + Intergenic
1069765942 10:70859925-70859947 TAGGGGAATGGTAGGTATGCAGG - Intronic
1070674366 10:78402140-78402162 CAGGGGACAGGAAGGGATGGTGG + Intergenic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1074036013 10:109739332-109739354 CAGGGTAATGGGAGCTTTGCTGG + Intergenic
1074685912 10:115962295-115962317 CAGGGTGATGGCAGAGATGGGGG - Intergenic
1075694893 10:124426775-124426797 CAGGTTAAAGGAAAGGATCCTGG - Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1077518565 11:3017216-3017238 CACCGTCATGGAAGAGATGCGGG - Exonic
1078137285 11:8661954-8661976 CCCGGTAATGGAAAGGAGGCAGG - Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078927438 11:15887193-15887215 CAAGGTAATGGCAGGGAGGCTGG - Intergenic
1079112264 11:17611468-17611490 CAGGGAAGAGGAAGGGATGAAGG - Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1081611738 11:44567071-44567093 CAGGGACATGGTAGGGATGGGGG - Intronic
1081793131 11:45803132-45803154 TAGGGAAATGGGAGGGCTGCAGG - Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1083759432 11:64807588-64807610 CAGGTCAATGGAAGGGTTGATGG + Exonic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1086974220 11:93114381-93114403 CAGCCAAATGGAAGAGATGCAGG + Intergenic
1086983537 11:93224624-93224646 CAGGACAGTGGTAGGGATGCTGG - Intergenic
1088440039 11:109860114-109860136 CAGGAGAATGGAAAGAATGCTGG - Intergenic
1088809825 11:113384726-113384748 CAGGATAAAGGAATGTATGCAGG - Intergenic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1089672444 11:120065826-120065848 CTGGGAAATGGAAGGGAACCTGG + Intergenic
1090631562 11:128653649-128653671 AATGTTAATGGAAGGGAGGCAGG - Intergenic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1092092138 12:5812147-5812169 CAGGGGAGTGGAGGGGAGGCAGG + Intronic
1092759921 12:11800559-11800581 CAGAGTAAAAGAAGGGATGCGGG - Intronic
1094475933 12:30840495-30840517 CAGGATGATGGTAGTGATGCAGG + Intergenic
1096588462 12:52641522-52641544 CAGGGAGAAGGAGGGGATGCTGG + Intergenic
1100372301 12:93979564-93979586 CAGAAAAATGGAGGGGATGCTGG - Intergenic
1100768814 12:97898561-97898583 CAGGGAAGTGGAAGGGATCCAGG - Intergenic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1102013927 12:109635547-109635569 AATGGTAATGGAAGTGATGATGG - Intergenic
1104725087 12:131070969-131070991 CAGGGGAATGTAAGAGAGGCTGG + Intronic
1109211854 13:59544456-59544478 AATGGTAATGGATGGAATGCAGG + Intergenic
1111073061 13:83195071-83195093 AAGGGGAAAGGAAGGGATGGTGG + Intergenic
1113382083 13:109813407-109813429 CAGGGTGTTGGAAGGGATTATGG + Intergenic
1114773293 14:25453310-25453332 CAGAGAAATGGAAGAGATGTTGG - Intergenic
1114925501 14:27392353-27392375 CAAGTAAATGTAAGGGATGCTGG + Intergenic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117002351 14:51383734-51383756 CAGGGTCCTGGAAGGAATTCAGG - Intergenic
1118102929 14:62626417-62626439 CAGGTTAATGGAGGAGAAGCTGG + Intergenic
1119706791 14:76788087-76788109 AAAGGAAATGGAAGGGAAGCGGG + Exonic
1121129157 14:91429415-91429437 CTGGGTAATGGAAGAGAAACAGG + Intergenic
1121295814 14:92821098-92821120 CAGGGTAATAGAAAGCATTCTGG - Intronic
1122270283 14:100565933-100565955 CAGGGGAGTGGAAGGGAAGTTGG - Intronic
1123046120 14:105516652-105516674 TAGGGAAATGCAAGGGATCCAGG + Intergenic
1124001409 15:25763441-25763463 CCCAGTACTGGAAGGGATGCTGG - Intronic
1124620558 15:31271664-31271686 TGGGGTCGTGGAAGGGATGCAGG + Intergenic
1128619309 15:69135381-69135403 GAGGGGCATGGAAAGGATGCGGG + Intergenic
1129220333 15:74128591-74128613 CTGGGTAATGGAAGGGAGAATGG - Exonic
1129938414 15:79470984-79471006 CAGGGTCAGGGAAGGAAGGCTGG - Exonic
1130876843 15:88022014-88022036 CAGGGTAAGGGAAGGGCTTAGGG - Intronic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131184415 15:90262853-90262875 CTGGGTCAGGGAAGGGATGAGGG + Intronic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1133815975 16:9197745-9197767 CAGGGGAAAGGATGGGAAGCAGG - Intergenic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1137426853 16:48386967-48386989 TTGGGTAGAGGAAGGGATGCGGG - Intronic
1138539550 16:57679989-57680011 GAGGGGAAGGGAGGGGATGCAGG - Intronic
1138604926 16:58082543-58082565 CAGGGATATGGAAGGGAGGCAGG - Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140037531 16:71382647-71382669 AAGGGGAATGGAAGGGAGGTGGG + Intronic
1140161557 16:72500723-72500745 CAGGGTAACGGAATGTAAGCAGG - Intergenic
1140427213 16:74870911-74870933 CAGGATACTGGAAAGGATGGGGG - Intergenic
1141377509 16:83545550-83545572 AAGGGTAATGGACTGGAGGCTGG - Intronic
1143270260 17:5670012-5670034 CAGGCTGATGGAAGGGAGGCAGG - Intergenic
1146471254 17:33126836-33126858 AAGAGTAATGGTAGGGTTGCTGG - Intronic
1148866809 17:50633045-50633067 CAGGGTCATGGAAGGGGTGGAGG + Intergenic
1149606289 17:57927316-57927338 CAGGGCAATGGCAGGGCTTCTGG - Intronic
1151026753 17:70686004-70686026 CAGGGTAGGGGAAGGGTTTCAGG - Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152501924 17:80717838-80717860 CAGGGGAATGCAAGGGAGGGCGG - Intronic
1152541816 17:80980359-80980381 CAGGGGAATGGAGGTGGTGCTGG - Intergenic
1152565009 17:81096467-81096489 CAGGGAACTGCCAGGGATGCTGG - Intronic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1157757013 18:50227879-50227901 AAGAGTAAGGGAAGGGATGGAGG - Intronic
1160698445 19:495497-495519 GAGGGATCTGGAAGGGATGCTGG - Intronic
1161144323 19:2668512-2668534 CAGGGAGATGGAGGGGCTGCTGG + Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1163296423 19:16415787-16415809 CAGGGTCTAGGAAGGGACGCTGG - Intronic
1164601001 19:29563105-29563127 CAGGGGCATGGAGGGGATGCCGG + Intronic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165094538 19:33403044-33403066 CAGGATACGGGAAGGGCTGCTGG + Intronic
1165285094 19:34835028-34835050 CATGATATTGGAAGTGATGCTGG - Intergenic
1166144194 19:40823098-40823120 CAGGGACATGCAAGGGATGGAGG - Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167509140 19:49887236-49887258 CATGGACATGGAAGGGAGGCAGG - Intronic
1167974279 19:53211214-53211236 CAAGGTGATGGAAGGAATGCAGG + Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
927081328 2:19633749-19633771 CAGGAGGAGGGAAGGGATGCTGG - Intergenic
927348374 2:22074691-22074713 AAGGGTAATGGGAGGGGTGAAGG + Intergenic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
930063631 2:47311044-47311066 CAGGGTTGTGGCAGTGATGCAGG + Intergenic
932597930 2:73105793-73105815 CAGGGTCATGGAAGACATGGGGG + Intronic
932795087 2:74687589-74687611 CTGGGTAATGGAAAGAACGCAGG + Intergenic
935801452 2:106700918-106700940 CAGGGTACTGGAAGAGAGACAGG + Intergenic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936479899 2:112876616-112876638 CAGGGTTAATGAAGGAATGCAGG + Intergenic
941586388 2:167364241-167364263 AAGGTTAATGGGAGTGATGCTGG + Intergenic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
943493805 2:188592181-188592203 CAGGGTAATTGAAGTGATACTGG + Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944995062 2:205284614-205284636 CAGAGTAATGGAAGCAAAGCAGG - Intronic
947655341 2:231821889-231821911 CAGGATAATGGAGGGGGTGCGGG - Intergenic
947891493 2:233625789-233625811 AAGGGGAGAGGAAGGGATGCAGG + Intronic
948918350 2:241049810-241049832 CAGGGTGATGGCAGGGCTGGGGG - Exonic
1170626607 20:18034851-18034873 CAGGGGATTGGAAGAGATGGGGG + Intronic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1170977696 20:21181977-21181999 CAGGGAAATGGAAAGGATCTGGG - Intronic
1172088943 20:32413320-32413342 GATGGAAATGGAAGGGATGGTGG + Intronic
1173048681 20:39537876-39537898 CAGGGCAATGGAAAACATGCTGG + Intergenic
1173476270 20:43362077-43362099 CAGGGTTATAGTAGGGATCCAGG + Intergenic
1175220654 20:57414638-57414660 CAGGGTAAGCGAAGCGATGGAGG + Intergenic
1176301606 21:5101478-5101500 CAGGGGCAGGGCAGGGATGCAGG + Intergenic
1178235205 21:30833803-30833825 AAGGGTAAGGGAAGTGAAGCAGG - Intergenic
1179556100 21:42177465-42177487 AAGGGTAAAGGAAAGGACGCAGG - Intergenic
1179855425 21:44160421-44160443 CAGGGGCAGGGCAGGGATGCAGG - Intergenic
1179924090 21:44522852-44522874 CAGGCCCATGGCAGGGATGCTGG - Intronic
1181052036 22:20242457-20242479 CAAGGTCACGGAAGGCATGCGGG + Exonic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1182133716 22:27880497-27880519 GAGGGTAATGGAGGTGATGGGGG - Intronic
1183022959 22:35042202-35042224 CAGCTTGATGGAAGGGATGGTGG + Intergenic
1183250247 22:36725293-36725315 CTGTGAAATGGAAGGGATGCTGG + Intergenic
1183250541 22:36727092-36727114 CTGTCAAATGGAAGGGATGCTGG - Intergenic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951702494 3:25510219-25510241 AAGGGTAGTTGAAAGGATGCTGG - Intronic
952262337 3:31752693-31752715 CTGGGTAAAGCAAGGGCTGCGGG + Intronic
952344861 3:32473902-32473924 CATGGTAAAGGGAGGGATGGAGG - Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
954304887 3:49720382-49720404 CAGGGAGACGGAAAGGATGCAGG + Exonic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954803132 3:53198926-53198948 GAAGGTAGTGGCAGGGATGCAGG + Intergenic
954899667 3:54008053-54008075 CAGGGAAAAAGAAGGGACGCAGG + Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
956055576 3:65295140-65295162 CACAGTAAAGGAAGGGATGAGGG + Intergenic
956672973 3:71708633-71708655 CAGGGTTATGCAAGGGGTTCTGG - Intronic
960046744 3:113205899-113205921 CTGGGTATTGCAAGGGCTGCTGG - Intergenic
960165669 3:114398478-114398500 CAGGGCAATGGCAGTGATGGCGG - Intronic
964076842 3:152701925-152701947 AAGAGTTATGGAAGGGATCCAGG - Intergenic
966364770 3:179173484-179173506 CAGGGGAATGGCAGGAATCCGGG + Intronic
968642713 4:1722334-1722356 CAGGGCAGGGGAAGGGGTGCTGG - Intronic
968781774 4:2587867-2587889 CATCCTAATGGAAGTGATGCAGG + Intronic
969433961 4:7173339-7173361 GAGGGTAAAGGAAGGGAAACAGG + Intergenic
976222811 4:82771682-82771704 CAGGGTTAATGAAGGGATTCAGG - Intronic
977905952 4:102478097-102478119 CAGGGAAATGCAAGGGATAGAGG + Intergenic
980172150 4:129302847-129302869 AAGGGTAATGGGTGGGATGGGGG + Intergenic
980869035 4:138589405-138589427 GTGGGTAATGGAAGTGATGCTGG + Intergenic
980881060 4:138710259-138710281 CTGGGTAATGTAATGGAGGCTGG - Intergenic
981417215 4:144507193-144507215 CAGGGTAATGGAAGAAAAGCTGG + Intergenic
984576984 4:181462313-181462335 CAGGGAAATGGAAAGGACTCTGG - Intergenic
984699462 4:182809397-182809419 CAGGGCAAAGCATGGGATGCTGG - Intergenic
984822427 4:183893471-183893493 CTGGGTGATGCAAGTGATGCTGG + Intronic
985828877 5:2213325-2213347 CAGGGTAAGGGAGGGGCTCCAGG + Intergenic
987797514 5:22648549-22648571 AAGGGTCATGGAAGGGATATCGG - Intronic
989821220 5:45797348-45797370 CAGGGTATTAGAAGGGCTGTTGG - Intergenic
992352048 5:75939924-75939946 CGGGGCAAGGGAAGGGTTGCTGG - Intergenic
992789169 5:80198381-80198403 GAGGGGACTGCAAGGGATGCTGG - Intronic
993682347 5:90895340-90895362 GAGAGTAATTGAAGGGATGTGGG + Intronic
994122565 5:96133389-96133411 CAGAATAATGGAAGGAGTGCTGG + Intergenic
994313624 5:98306327-98306349 CAGGGGGATGGAAGGGGTGTTGG + Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
994903610 5:105806711-105806733 CAGGGCAAAGTAAGGTATGCAGG - Intergenic
995127253 5:108590581-108590603 CAGGGTAATGGCAGGGAGAATGG + Intergenic
997188007 5:131901259-131901281 CAGGGTAGGGGAAGGTCTGCCGG - Intronic
998897825 5:146818753-146818775 CAGGTTAATAGAAAGGATGCTGG + Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000520362 5:162287435-162287457 CAGGGAAATTGAAAGGATGTAGG + Intergenic
1001526591 5:172433544-172433566 CAGGGTAACGGAGAAGATGCTGG - Intronic
1002842851 6:921257-921279 CAGGGTTTTGGAAGAGAGGCAGG - Intergenic
1004406317 6:15337082-15337104 CAGGGTTTTGGAAGAGAGGCAGG - Intronic
1006615993 6:35327328-35327350 CAGGGTGATGGAAAGGACACAGG - Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007629532 6:43265127-43265149 GAGAGTCATGGAGGGGATGCCGG + Intronic
1008032606 6:46713930-46713952 CAGGCCAATGGAAGGAGTGCTGG - Intronic
1008045259 6:46845191-46845213 CAGGCCAATGGAATGGAAGCAGG + Intergenic
1013313453 6:108919047-108919069 TAGGGTAATGTATGGGATTCTGG + Intronic
1016352574 6:143183936-143183958 CAGGGAACTGGAAAGGATACAGG - Intronic
1017014712 6:150090681-150090703 CCGGGTAGTGGAAGGAAGGCAGG + Intergenic
1017319686 6:153075427-153075449 CAGGGTAGAGGTAGGGATGGGGG - Intronic
1017671336 6:156772124-156772146 CAGGGTGAGGGCAGGCATGCTGG - Intergenic
1017791867 6:157807000-157807022 AAGGGTAGTGGTAGGAATGCAGG - Intronic
1018033047 6:159858926-159858948 CCAGGTAATGGAAGGGACGTGGG - Intergenic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1019426961 7:982511-982533 CAGGAACATGGAAGGGCTGCCGG - Intergenic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019921054 7:4163479-4163501 GCGGGAAATGGAAGGGATGCTGG + Intronic
1020758132 7:12231347-12231369 CAGGAAAATGGAAAGGATACAGG + Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1021849825 7:24796413-24796435 CAGGTTACTGGAAGTGATGGGGG - Intergenic
1026176042 7:67997928-67997950 CAGGATAATGGAGTGGATGTGGG + Intergenic
1026549023 7:71351288-71351310 GAGGGTGATGGAAGGGAGGTAGG + Intronic
1027478153 7:78659623-78659645 AAGGGTAAAGGAGAGGATGCAGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030180667 7:106705528-106705550 CAGGATGATGGAAGAGAAGCAGG - Intergenic
1031133549 7:117861241-117861263 CAGCGTGATGGAAGGGGAGCTGG - Exonic
1031247418 7:119333069-119333091 AAGGGTAATAGAAGGGTTGGGGG - Intergenic
1033438375 7:141355102-141355124 GGGGGTGATGGAAGGGATGAAGG + Intronic
1034606811 7:152323782-152323804 GAGGGGAAGGGAAGGGAGGCAGG + Intronic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1035389660 7:158496534-158496556 CAGGGAAGAGGAAGGGGTGCAGG - Intronic
1035600914 8:896280-896302 GGGGATAATGGATGGGATGCAGG + Intergenic
1035992597 8:4509538-4509560 CATGGAAATGGAAAGGATGCTGG + Intronic
1037791009 8:21941672-21941694 TAAGGAAATGGGAGGGATGCTGG + Intronic
1045290164 8:100826138-100826160 AAGGGTAATGGCAAGGATGGTGG - Intergenic
1046873544 8:119229198-119229220 CAGGGACAAGGAAGGGATACGGG - Intronic
1047374646 8:124284446-124284468 AAGGAGAATGGAAGGAATGCAGG + Intergenic
1048600699 8:135916240-135916262 CATGGGAAATGAAGGGATGCGGG + Intergenic
1049261676 8:141642266-141642288 CAGGGTCCTGGGAGGGGTGCAGG + Intergenic
1049303179 8:141882613-141882635 CAGGGAGATGGAGGGCATGCAGG - Intergenic
1050150877 9:2618373-2618395 CAAGGCAATGGAAGGGATTCAGG - Intergenic
1052397056 9:27950787-27950809 AAGTGTAATGGAAAGGATACTGG + Intronic
1052998929 9:34566548-34566570 CAGGTTTTTGGAAGGGAGGCTGG - Intronic
1053062338 9:35042248-35042270 AAGGGAAATGGAATGGCTGCTGG + Exonic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1055761927 9:79618149-79618171 CAGTGTAAGAGAAGGGATACTGG + Intronic
1056341725 9:85641491-85641513 CGGGGTAATAGAAGGAAGGCAGG - Intronic
1059345894 9:113627753-113627775 CAGACTCATGGAAGAGATGCAGG + Intergenic
1060114251 9:120928474-120928496 CCGGGGAAAGGAAGGGATTCCGG - Exonic
1060523242 9:124306179-124306201 CTTGGTAGTGGAAGGGATGAGGG + Intronic
1061203647 9:129150926-129150948 CAGGGAAATGTAAGGCATGAGGG + Intergenic
1061465641 9:130777266-130777288 CATGGGAATGGAAGGGGTGTTGG + Intronic
1186819484 X:13272341-13272363 CATGGTGATGGAAGGGAGCCTGG + Intergenic
1189462060 X:41250861-41250883 AAGGGTGAGGGAAGGTATGCAGG + Intergenic
1190708820 X:53050782-53050804 GAGGGTAGTGGAAGGGAGGCAGG + Intronic
1190909057 X:54755591-54755613 AAGGGCAATGGAAGGGATAAGGG + Intronic
1192291883 X:69806178-69806200 CAGTGTAATGAAAGGAATACTGG + Intronic
1192433104 X:71125859-71125881 GAGGGTCAAGGAAGGGATGGGGG - Intronic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196070373 X:111514622-111514644 GAGGGTAATGGAAGGAATTAAGG + Intergenic
1201096707 Y:10627143-10627165 TAGTGTAATGGAAGGGATTGGGG - Intergenic