ID: 1076554301

View in Genome Browser
Species Human (GRCh38)
Location 10:131311835-131311857
Sequence CCGCCCGCGCCCCTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 1, 2: 5, 3: 84, 4: 617}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076554276_1076554301 24 Left 1076554276 10:131311788-131311810 CCCGCGCCGCCGCCGCCCCCGGA 0: 1
1: 3
2: 57
3: 412
4: 3094
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554292_1076554301 -7 Left 1076554292 10:131311819-131311841 CCGCCCCGGTCCCCGCCCGCCCG 0: 1
1: 3
2: 19
3: 153
4: 1133
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554293_1076554301 -10 Left 1076554293 10:131311822-131311844 CCCCGGTCCCCGCCCGCCCGCGC 0: 1
1: 2
2: 14
3: 105
4: 861
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554291_1076554301 -6 Left 1076554291 10:131311818-131311840 CCCGCCCCGGTCCCCGCCCGCCC 0: 1
1: 4
2: 28
3: 289
4: 2111
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554280_1076554301 15 Left 1076554280 10:131311797-131311819 CCGCCGCCCCCGGACCCGGCCCC 0: 1
1: 3
2: 34
3: 386
4: 1984
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554283_1076554301 8 Left 1076554283 10:131311804-131311826 CCCCGGACCCGGCCCCCGCCCCG 0: 1
1: 6
2: 105
3: 347
4: 1606
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554273_1076554301 28 Left 1076554273 10:131311784-131311806 CCCGCCCGCGCCGCCGCCGCCCC 0: 1
1: 10
2: 82
3: 753
4: 2823
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554290_1076554301 -5 Left 1076554290 10:131311817-131311839 CCCCGCCCCGGTCCCCGCCCGCC 0: 1
1: 3
2: 23
3: 280
4: 1886
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554277_1076554301 23 Left 1076554277 10:131311789-131311811 CCGCGCCGCCGCCGCCCCCGGAC 0: 1
1: 1
2: 21
3: 210
4: 1222
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554284_1076554301 7 Left 1076554284 10:131311805-131311827 CCCGGACCCGGCCCCCGCCCCGG 0: 1
1: 1
2: 109
3: 318
4: 1612
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554279_1076554301 18 Left 1076554279 10:131311794-131311816 CCGCCGCCGCCCCCGGACCCGGC 0: 1
1: 0
2: 15
3: 216
4: 1464
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554274_1076554301 27 Left 1076554274 10:131311785-131311807 CCGCCCGCGCCGCCGCCGCCCCC 0: 2
1: 30
2: 197
3: 2147
4: 5279
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554286_1076554301 6 Left 1076554286 10:131311806-131311828 CCGGACCCGGCCCCCGCCCCGGT 0: 1
1: 0
2: 7
3: 243
4: 1091
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554281_1076554301 12 Left 1076554281 10:131311800-131311822 CCGCCCCCGGACCCGGCCCCCGC 0: 1
1: 1
2: 23
3: 339
4: 1776
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554287_1076554301 1 Left 1076554287 10:131311811-131311833 CCCGGCCCCCGCCCCGGTCCCCG 0: 1
1: 2
2: 42
3: 464
4: 1860
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554282_1076554301 9 Left 1076554282 10:131311803-131311825 CCCCCGGACCCGGCCCCCGCCCC 0: 1
1: 2
2: 36
3: 314
4: 1906
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554288_1076554301 0 Left 1076554288 10:131311812-131311834 CCGGCCCCCGCCCCGGTCCCCGC 0: 1
1: 6
2: 163
3: 634
4: 3274
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617
1076554289_1076554301 -4 Left 1076554289 10:131311816-131311838 CCCCCGCCCCGGTCCCCGCCCGC 0: 1
1: 5
2: 42
3: 370
4: 1781
Right 1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG 0: 1
1: 1
2: 5
3: 84
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076554301 Original CRISPR CCGCCCGCGCCCCTCCCCGC CGG Intergenic
900096415 1:941864-941886 CCGCCTGCTCCCCTCCCCTGCGG - Intronic
900113554 1:1019610-1019632 CAGGCCGCGCCCCTCCCCCGCGG - Intergenic
900119079 1:1040988-1041010 CCAGCCCCGCTCCTCCCCGCCGG - Intronic
900119117 1:1041063-1041085 CCAGCCCCGCTCCTCCCCGCCGG - Intronic
900157459 1:1208923-1208945 CCCCCCGCCCCCCGCCCCGTGGG - Intergenic
900245105 1:1632931-1632953 CCGGCCGCGCCCCCTCCCCCGGG - Intronic
900256336 1:1700090-1700112 CCGGCCGCGCCCCCTCCCCCGGG - Intronic
900349487 1:2227961-2227983 CCGCCCGCTCCGCCCCGCGCCGG - Intergenic
900366814 1:2314910-2314932 AAGCCCCCGCCCCACCCCGCCGG - Intergenic
900368168 1:2319943-2319965 CCGCCCGCCCCTCTGCCCCCGGG + Intergenic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
900633904 1:3652527-3652549 CCGCCCGCGCACCCGCCCGGAGG + Exonic
900794324 1:4698899-4698921 CTGCCCAAGCCACTCCCCGCTGG - Intronic
900991466 1:6100198-6100220 TCGCCCCAGCCTCTCCCCGCTGG - Exonic
901086414 1:6614418-6614440 CGCCCCCAGCCCCTCCCCGCCGG + Intronic
901088234 1:6625128-6625150 GCGGCCCCGCCCCTCCCCGCAGG + Exonic
901242651 1:7704284-7704306 CCTCCCGTTCCCCTTCCCGCGGG - Intronic
901308493 1:8250754-8250776 CTGGCCGTGCCCCTCCCCACGGG - Intergenic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
901791335 1:11654957-11654979 CCCCCCGCGCCCCCTCCTGCCGG - Intronic
901793073 1:11664519-11664541 CCGCCCGCGCCCCCCACCCCTGG - Intronic
902018886 1:13328959-13328981 CCGCCCTCCCCCCTCCCGGACGG - Intergenic
902169525 1:14598863-14598885 TCGCCCGCGCCCCGACCCCCAGG - Exonic
902361541 1:15944888-15944910 CAGCCAGCGTCCCTCCCCTCCGG - Intronic
902505971 1:16939201-16939223 CCGCCCCCGCCCCCACCCGGAGG - Intronic
902519808 1:17009888-17009910 CCTCCAGAGCCCCTCCCTGCAGG + Intronic
902801066 1:18830639-18830661 GCCCCCGCGCCCCTCCTCGTCGG + Intergenic
903212798 1:21828210-21828232 CCACCTGTGCCCCTCCCCTCCGG + Intronic
903222325 1:21875824-21875846 CTGCCCGCACCCCTACCCCCAGG + Intronic
903263448 1:22143176-22143198 CCGCCCCCGGCCCGCCCCCCCGG - Intronic
903408279 1:23117505-23117527 CCCCCCCCGCCCCCCCCCCCAGG - Intronic
903649578 1:24914544-24914566 CCGCTCGCCTCCCTGCCCGCTGG - Intronic
903883717 1:26529629-26529651 CCGCCCCCGCCGCGCCCCGAGGG - Intergenic
903925232 1:26826926-26826948 CCGCCCCCGCCCCGCCGCGCTGG + Exonic
904500061 1:30908358-30908380 CCGCCCGCGACCCCCCCTCCGGG - Intronic
904775097 1:32901451-32901473 CGGCTCGTGCCCCTCCCGGCCGG + Intergenic
905374893 1:37513918-37513940 CAACTCGCTCCCCTCCCCGCAGG + Intronic
905685003 1:39901708-39901730 GCGCCCCCGCCCGGCCCCGCCGG - Intronic
906214257 1:44030143-44030165 CCGACCGCGCCCCTGCCCGCCGG - Intronic
907488888 1:54796271-54796293 CCGCCAGGTCCCCACCCCGCTGG + Intronic
908354574 1:63317583-63317605 GGGCGCGCGCCCCTCTCCGCCGG - Intergenic
908477764 1:64505856-64505878 CCCGCCCCGCCCCGCCCCGCCGG + Intronic
908534693 1:65066931-65066953 CCCTCCGCGCCGCTCCCCTCCGG + Intergenic
910221496 1:84893252-84893274 CCTGCCCCGCCCCGCCCCGCCGG + Intergenic
912174758 1:107141503-107141525 TCGCCCGTGCCCCTCTCCCCCGG + Intronic
912494822 1:110084587-110084609 CCTCCGGCTCCGCTCCCCGCAGG - Intergenic
913047925 1:115089499-115089521 CCGCTCCGCCCCCTCCCCGCCGG - Intronic
913047959 1:115089561-115089583 GTCCACGCGCCCCTCCCCGCCGG - Intergenic
914200011 1:145476121-145476143 CTGCCCGTTGCCCTCCCCGCGGG - Intergenic
915167792 1:153958268-153958290 CCGCCCCCGCCCCGCCTCTCCGG + Intronic
915302976 1:154962003-154962025 TCGCGCGCGCCCCTCCGCGGCGG - Intronic
916259045 1:162822495-162822517 CCGCCCGCGCCAGTCCCGCCCGG - Intergenic
916499672 1:165376139-165376161 CGCCCCGCGCCCAGCCCCGCCGG + Intergenic
918048289 1:180954212-180954234 CCGCCCGCGCGAGGCCCCGCGGG - Intergenic
918174367 1:182029978-182030000 CCGCCCGCCCCGCCCCCCGGGGG - Intergenic
918282838 1:183023177-183023199 CCTCGCGCGCCCCTCCCCCCGGG + Intergenic
919826562 1:201507275-201507297 CTGCCCCCGCCCCTGCCGGCCGG - Exonic
919973871 1:202598519-202598541 CCACCCCCTCTCCTCCCCGCAGG - Intronic
920184591 1:204152082-204152104 CCGCCCCCGCCCCGGCCCGCGGG + Intergenic
920504629 1:206507466-206507488 CCGCCCCCGCCCCGCCCAGCAGG + Intergenic
921355441 1:214281059-214281081 GGGCCCGTCCCCCTCCCCGCGGG + Intergenic
922467982 1:225857375-225857397 CCCCCCCCCCCCCGCCCCGCCGG - Intronic
922744913 1:228038251-228038273 ACGCCCGGGCGCCTCCCCTCGGG - Intronic
922951065 1:229558752-229558774 TGGCGCCCGCCCCTCCCCGCTGG + Intergenic
923126782 1:231040305-231040327 CCTCCCGCGCCACGCCCCCCCGG + Intergenic
923631187 1:235650176-235650198 GCGCCCCCGCCCCGCCCCCCCGG + Intronic
924706583 1:246507320-246507342 CCGCGCCCGCCCCGCCCCTCGGG - Intergenic
1062774708 10:135504-135526 CCGCGCCCGGCCCTCCCCTCCGG - Intronic
1062843904 10:690039-690061 CCCGCCCCGCCCCGCCCCGCGGG - Intergenic
1063130293 10:3172459-3172481 CTGCCCGCGGCGCTCCCGGCGGG - Intronic
1063458955 10:6203452-6203474 GCGCCTCCGCCCCGCCCCGCCGG - Intronic
1064418095 10:15168215-15168237 CCAGCCTCGCCCATCCCCGCCGG - Intronic
1065188745 10:23192440-23192462 CCGTCCGAGCCCCTCCCTCCCGG - Exonic
1065325996 10:24551320-24551342 CTGGCCACTCCCCTCCCCGCAGG + Intergenic
1065590281 10:27256472-27256494 CCACCCGCGCCTCTCCCTCCAGG - Intergenic
1065712948 10:28533902-28533924 CCCCCGCCGCCCCTCCCCGCGGG - Intronic
1067096542 10:43305058-43305080 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1069695511 10:70382628-70382650 CCCCGCGCGCCCCGCCCCGCCGG - Intronic
1070367331 10:75750255-75750277 CTGCCCACCTCCCTCCCCGCCGG + Intronic
1072227908 10:93387249-93387271 CTGCCCGCGGCCCTCCTTGCTGG - Intronic
1072700919 10:97640868-97640890 CGGCTCGGGCCCCTCTCCGCCGG + Exonic
1073062710 10:100741982-100742004 CCAGCCGCGCCCCTCCCCCGTGG - Intronic
1073465632 10:103693229-103693251 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
1074085611 10:110207463-110207485 CCGCCCCTGCCCGTCCCCGCAGG - Intergenic
1074130387 10:110568163-110568185 CCGCCCGCGGCCGCCCCGGCGGG - Intronic
1075112292 10:119596997-119597019 CCGCCGGCGCCCACCCGCGCTGG + Intronic
1075802536 10:125161541-125161563 CGGCCCGCGCCTGACCCCGCGGG - Intergenic
1076404684 10:130203895-130203917 CCGCCCCCGCCCGATCCCGCCGG + Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076792828 10:132785990-132786012 CCGCCGCCGCCCCTGCCCGCCGG + Exonic
1076804592 10:132849132-132849154 CTGCCCTGGCCCCTCCTCGCTGG + Intronic
1076808007 10:132869021-132869043 TGGCCCGAGCCCCTCCCCGGAGG - Intronic
1076899415 10:133330005-133330027 CCGCCCTCTCCCAGCCCCGCGGG - Intronic
1076908212 10:133373598-133373620 CCGCCCCCGCCCCAGCCCTCGGG + Exonic
1076908267 10:133373741-133373763 CCGCCTGCCCGCCTGCCCGCCGG + Intergenic
1077093592 11:790157-790179 GCGACCGGGCCCCGCCCCGCCGG + Intergenic
1077100203 11:819231-819253 CAGCCACCGCCCCTCCCCACCGG - Intronic
1077142082 11:1029187-1029209 CCGGGAGCGCCCCTCCCCACGGG + Intronic
1077179846 11:1207377-1207399 CTGCCAGGGCCCCTCCCAGCAGG - Intergenic
1077210818 11:1370240-1370262 CCGCCCGCTGCCCTCCACGCTGG + Intergenic
1078266374 11:9758670-9758692 CCACCCGACCACCTCCCCGCGGG - Intergenic
1078317001 11:10302815-10302837 CCCGCCGCGCCCCACCCCCCAGG + Intergenic
1079296701 11:19241249-19241271 TCGCCCCCGCCCCTCTGCGCGGG + Intronic
1079353450 11:19712614-19712636 CCGGCCGCGCGCCTCCCGGGGGG - Intronic
1081636896 11:44727352-44727374 CCCCCCGCGCGCCGCCCCGGGGG + Intronic
1081831467 11:46119881-46119903 CCGCCCGCGCCCCCGCCGGGGGG - Intronic
1081866501 11:46363280-46363302 GCTCCCATGCCCCTCCCCGCAGG - Intronic
1081873199 11:46392335-46392357 CCGACGGCGCCCCTCCTCGCGGG - Intergenic
1081938065 11:46918384-46918406 CCGCCCGCGCCGCTCGCCCGGGG + Exonic
1083039030 11:59668774-59668796 CAGCCCGCCCCCTGCCCCGCAGG + Intronic
1083572863 11:63769276-63769298 GCGGCCGCGCCCCCTCCCGCGGG + Intergenic
1083618310 11:64036857-64036879 CGGCGCACGCCCCTCCTCGCGGG + Intronic
1083771263 11:64868972-64868994 CCTCCCGCGGCCCTCCAAGCTGG - Intronic
1083814988 11:65127740-65127762 CCTGCCCCGCCCCTCCCCCCAGG - Exonic
1083885713 11:65572599-65572621 CCGCCCGGGCCGCCGCCCGCAGG - Exonic
1083895205 11:65616276-65616298 CTGCCCGCGCCCCCCCTCCCGGG - Exonic
1083943836 11:65913012-65913034 CTGCCAGAGCCCCTCCCAGCCGG + Intergenic
1083970247 11:66070203-66070225 CCGGCCCGGCCCCTCCGCGCTGG + Intergenic
1084182565 11:67454213-67454235 CCCACCTCGCCCTTCCCCGCTGG + Intronic
1084332860 11:68439911-68439933 CCGGCCCCGCCCCTCACCGGCGG - Exonic
1084416391 11:69035363-69035385 GCCCCTGCGCCCCTCCACGCAGG + Intergenic
1084433403 11:69123802-69123824 CCCGCCACGACCCTCCCCGCTGG + Intergenic
1084665339 11:70573312-70573334 CCGCCCCCCCCCCCCACCGCTGG - Intronic
1084712400 11:70852101-70852123 CTGCCCACGCTCCTCCCCGGCGG - Intronic
1084757678 11:71250104-71250126 CAGACCGCCCCCCTCCCCGGGGG + Intronic
1084935107 11:72582744-72582766 CACCCCGCGCGCCTCCCTGCAGG + Intronic
1084973109 11:72781914-72781936 CCCGCCCCGCCCCACCCCGCAGG + Intronic
1085289855 11:75390153-75390175 GCGCCAGCGTCCCTCGCCGCCGG + Intergenic
1085312703 11:75525705-75525727 CGGCCGCCGCGCCTCCCCGCCGG - Exonic
1085396526 11:76209574-76209596 CCGGCCTCGCCCCGCCCCGCAGG - Intronic
1085416527 11:76322126-76322148 CCGCACGCGCCGACCCCCGCCGG - Intergenic
1085417811 11:76330869-76330891 CCGCCCGCCTCACTCACCGCTGG + Intergenic
1085726922 11:78962278-78962300 CTCCCCGCCCCCCTCCCCTCCGG - Intronic
1086464353 11:87037979-87038001 GCTCTCGCGCCCCTCCCTGCAGG + Intronic
1086887806 11:92224854-92224876 GAGCCGGCGCTCCTCCCCGCAGG + Intergenic
1087076211 11:94129089-94129111 CCCGCCCCGCCCCGCCCCGCCGG + Exonic
1087188691 11:95230720-95230742 CCGCCCGAGCCCCGGCCGGCAGG + Intronic
1088481742 11:110301260-110301282 CCTCCCGCGCCTCTCCCTCCGGG + Intergenic
1088686739 11:112290203-112290225 CCGCCCGCGTCCCCGCCCCCCGG - Intergenic
1089273360 11:117316129-117316151 CTGCCCGCGCCGCCGCCCGCCGG - Exonic
1089442908 11:118531245-118531267 CCGCCCCCGCCCCCCGCCACCGG - Intronic
1089453862 11:118614455-118614477 CAGCCCTCGCCCCTCTCCGAAGG - Intronic
1089479101 11:118791023-118791045 CCGCCCCCGCCCCGCTCCGAGGG + Intronic
1089494987 11:118903299-118903321 CCGCCCCCGCCCCCGCCCCCAGG + Exonic
1090187125 11:124746063-124746085 CCACCCTCACCCCTCCCAGCCGG + Intronic
1090344967 11:126062567-126062589 CCACCCCCGCACCTCTCCGCGGG + Intronic
1090345067 11:126062883-126062905 GCGGCTGCGCTCCTCCCCGCCGG + Intronic
1090385543 11:126355871-126355893 CCCGCCCCGCCCCGCCCCGCGGG - Intronic
1090699118 11:129279074-129279096 CCCCCCGCAGCCTTCCCCGCGGG + Intronic
1090832351 11:130428257-130428279 CCGCCCCCGCCGCCCCCCGGTGG - Exonic
1091259770 11:134224929-134224951 CCGGCCGTGCCCCTCCCCCGTGG + Exonic
1091262523 11:134245646-134245668 CCGCCCCCGCCCCCAGCCGCTGG - Exonic
1091740765 12:2959256-2959278 CCGGCCCCGCCCCGCCCCGGCGG + Intergenic
1091866069 12:3838752-3838774 CCACCCGCTCCCCGCCCCTCCGG + Intronic
1093894675 12:24562724-24562746 CCGCCCCCGCCGCACCCCCCGGG - Intergenic
1094703997 12:32896964-32896986 CCGCCCCCGCCCCCGCCCCCGGG - Intergenic
1096336946 12:50764058-50764080 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1097872022 12:64610162-64610184 CCGCCCGCCCCCAGCCTCGCTGG - Intergenic
1101640133 12:106581637-106581659 CCGCCCCCGCCGCGGCCCGCCGG + Intronic
1101692413 12:107093999-107094021 CCGAGCGCGCTCCTGCCCGCCGG - Intergenic
1102025528 12:109712374-109712396 CCGCGGGCGCCTCTCCCGGCGGG + Intergenic
1102471400 12:113161797-113161819 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1103595634 12:122022847-122022869 CGCCCCGCGCCCCTGGCCGCTGG - Intronic
1103775690 12:123364864-123364886 CCTCCCCCGCCCCTCCCGGCGGG - Intergenic
1103779431 12:123389198-123389220 CCGCCCGCCCCCCGCGCGGCCGG - Intronic
1103856009 12:123972227-123972249 ACCCCCGCGCCCGCCCCCGCGGG - Intronic
1104289499 12:127455385-127455407 CTGCCCCCCCCCCGCCCCGCAGG + Intergenic
1104857478 12:131908844-131908866 GCCCCGGAGCCCCTCCCCGCCGG - Intronic
1104920199 12:132286499-132286521 CCTCCCGCCCCTCTCCCCGACGG + Intronic
1104989671 12:132618651-132618673 CCGGCCCCGCCCCGCCCCGCAGG - Intergenic
1104989952 12:132619417-132619439 CCGGCGCCGCCCCTGCCCGCAGG + Exonic
1105031478 12:132887395-132887417 CGGCGCCCGCCCCACCCCGCGGG + Intronic
1105327278 13:19382235-19382257 CCGCCCTCGTCCCGTCCCGCAGG - Intergenic
1105378061 13:19863196-19863218 CCGCCACCCCGCCTCCCCGCCGG + Intronic
1105800985 13:23903360-23903382 CCGGCCGCGCCCCTGCTCGGAGG + Intergenic
1106735871 13:32587022-32587044 CCCCCCGCGCCCCGGCCGGCCGG + Intronic
1107935363 13:45341381-45341403 CCGCCCCCACCCCTACCCGCTGG - Intergenic
1108220962 13:48233123-48233145 CCGCCCCCGCCCCGCCTCCCAGG + Intergenic
1108542069 13:51453634-51453656 CCGCCCGCGCCCGCTCGCGCCGG - Intronic
1110630156 13:77698112-77698134 CCCGCCGCGCCGCCCCCCGCTGG + Intronic
1112752559 13:102597223-102597245 CCGCCCGCGCCCCCGCGCCCGGG - Intronic
1113254908 13:108495918-108495940 CCGCCGACGCCCCTACCTGCCGG - Intergenic
1113473285 13:110561769-110561791 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1114483371 14:23048511-23048533 CCGCCCGCTCCCGGCCCTGCTGG - Intronic
1114957795 14:27845642-27845664 CCGCCCGCGCCTTCCCCTGCGGG + Intergenic
1117424465 14:55580387-55580409 CCCCCCGCGCTCCCCGCCGCCGG - Intronic
1117912442 14:60648552-60648574 CCGCCCCCTCCCGCCCCCGCAGG - Intronic
1118210527 14:63761929-63761951 CACCCCGTGCCGCTCCCCGCGGG - Intergenic
1118869109 14:69726849-69726871 CCGCCTGCGCGCCCCCACGCAGG + Intergenic
1119480580 14:74955463-74955485 CCCTCGGCGCCCCGCCCCGCCGG - Exonic
1120914814 14:89701701-89701723 CCCGCCCCGCCCCGCCCCGCTGG - Intergenic
1120993458 14:90397838-90397860 ACGCCCGCGCCGCGCCCCCCGGG - Intronic
1121101543 14:91253492-91253514 CCGCCCCCGCCACGCCCCGGCGG + Intronic
1121183613 14:91947787-91947809 GCGTGCACGCCCCTCCCCGCCGG - Exonic
1121311854 14:92939591-92939613 CCGCCCCCGCCCCACCACGGAGG + Exonic
1122227988 14:100290826-100290848 CCGCCAGTGCCCCTCACCACAGG + Intergenic
1122486775 14:102087193-102087215 CCGCCCCCGCGCCTTCCTGCGGG + Intronic
1122719869 14:103716022-103716044 CCGCCCCGGCCCGGCCCCGCGGG + Intronic
1123004606 14:105315150-105315172 CCCCCCGCGCCCCCGCCCGCCGG + Exonic
1123500649 15:20878195-20878217 CAGCCCGCACCCCTCTCCTCTGG + Intergenic
1123557894 15:21451888-21451910 CAGCCCGCACCCCTCTCCTCTGG + Intergenic
1123594123 15:21889169-21889191 CAGCCCGCACCCCTCTCCTCTGG + Intergenic
1124629271 15:31327627-31327649 CCGGGCTCGCCGCTCCCCGCGGG - Exonic
1124813930 15:32969050-32969072 CCCCCTCCGCCCCTCCCCTCAGG - Exonic
1125742036 15:41972162-41972184 CCGCCGCTGCCCCTCCCGGCCGG - Intronic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1127373779 15:58363445-58363467 ACAGCCGCGCCCCTTCCCGCAGG - Intronic
1128067884 15:64775653-64775675 CCGGCCCCGCCCCCCGCCGCCGG - Intergenic
1129298922 15:74614714-74614736 CCGCCCATGCCCCTCCCCGCGGG - Intronic
1129483223 15:75843867-75843889 CCGTCCTCGCCCTGCCCCGCGGG - Intronic
1130883373 15:88073777-88073799 ACCCCCCCGCCCCACCCCGCAGG + Intronic
1131144342 15:90001675-90001697 CCCCCCGCGCCCCCGCCGGCCGG - Intronic
1131517484 15:93088945-93088967 CCGCCAGCGCCACCCCCCGCGGG - Intronic
1202966245 15_KI270727v1_random:179060-179082 CAGCCCGCACCCCTCTCCTCTGG + Intergenic
1132480647 16:164841-164863 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
1132519783 16:381848-381870 CGGCCCGCGTCCCGCGCCGCCGG + Exonic
1132607350 16:799163-799185 CCACCCCCGCTGCTCCCCGCAGG + Intronic
1132610550 16:813786-813808 CGGGCCGCGCTCCTGCCCGCTGG + Exonic
1132663768 16:1072730-1072752 CCGCCCCGCCCCCTCCCAGCCGG + Intergenic
1132851516 16:2026961-2026983 TCCCCCGCGCCCCTGCCCGCGGG + Exonic
1132889332 16:2196309-2196331 CCACCCGCGCCCCGCGCCCCCGG + Intronic
1132915603 16:2341703-2341725 ACGCCCGGGACCCTCCCTGCAGG - Intergenic
1133118077 16:3589566-3589588 CCACCCGCACTCCTCTCCGCTGG - Exonic
1133267080 16:4591793-4591815 CCGCCCGAGCCCCTCCTGGTAGG + Intronic
1133286667 16:4693911-4693933 CCGCCCGGGCCCGCCCGCGCCGG - Intronic
1133304835 16:4802355-4802377 CGACCCGCGCCCTGCCCCGCCGG - Intronic
1133924679 16:10182950-10182972 CCGCCCGCGCCTCTCTCGGCCGG - Intergenic
1134121392 16:11586984-11587006 CCGGCCGCGCTCCGCCCCGGCGG - Intronic
1136146742 16:28320736-28320758 CGGCCCGCGCCCCCCGCCGTCGG + Exonic
1136382031 16:29900306-29900328 CCGCGCTCGCCCCGCCCCTCAGG + Intergenic
1136556509 16:31010520-31010542 CCGGCCCCGCCCCCGCCCGCAGG - Exonic
1139215540 16:65122254-65122276 CCGTCCGCGCCCCTCCCCCCAGG + Intronic
1139468060 16:67164653-67164675 CTGTCCGAGCCCCGCCCCGCGGG + Exonic
1139584485 16:67893198-67893220 CCGCCCCCGACCCGCCCCGTAGG + Intergenic
1140393283 16:74606776-74606798 CAGCCCCCGCTCCTCCCCGCCGG + Exonic
1140393377 16:74607179-74607201 CCTGCCGAGCCCCGCCCCGCCGG + Intergenic
1140509293 16:75495511-75495533 CGGCCGGCGCCCCTCCCCCGAGG - Intergenic
1141111384 16:81273479-81273501 ACGCCAGCTCCCCTGCCCGCTGG - Intronic
1141132397 16:81445064-81445086 CCGCACGCGCCGCCCCCCGCGGG + Intergenic
1141563395 16:84885138-84885160 CCACCCCCGCCCCTACCCGAGGG - Intronic
1141602815 16:85136768-85136790 CTGCCGGAGCCCCTCCCAGCCGG + Intergenic
1141647211 16:85373910-85373932 CCTCCCTCCCCGCTCCCCGCAGG + Intergenic
1141810199 16:86371035-86371057 CCCCACGCGCCCCTCCCCCCAGG + Intergenic
1141957776 16:87383890-87383912 CCGCGCCACCCCCTCCCCGCGGG + Intronic
1142136534 16:88454216-88454238 CGGCCCGCGCCCACCCCCACCGG + Intronic
1142240280 16:88941628-88941650 CTCCCCGCGCCGCCCCCCGCAGG - Intronic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142467381 17:144051-144073 CCGCCTGCGCCAATCCCCGACGG - Intergenic
1142474637 17:181552-181574 CAGCCCCCGCCGCGCCCCGCCGG - Exonic
1142509832 17:386265-386287 CCCGCCCCGCCCCGCCCCGCTGG + Intergenic
1142643651 17:1299096-1299118 CAGACCTCGGCCCTCCCCGCTGG - Exonic
1142974645 17:3636283-3636305 CCGCCCCTGCCCCGCCCCCCTGG - Exonic
1143373667 17:6455268-6455290 CAGCCCCCTCCCGTCCCCGCAGG + Exonic
1143625904 17:8110047-8110069 CCGCCCGGCCCCTGCCCCGCTGG + Intronic
1144269110 17:13600807-13600829 CCGCCCGCGCCCCGCGACGACGG - Exonic
1144608333 17:16687349-16687371 CCTCCCCCGCCGCCCCCCGCAGG + Intergenic
1144759748 17:17700619-17700641 CCATCCCCTCCCCTCCCCGCCGG - Intronic
1144948480 17:18981763-18981785 TCGCCGGCCCCCCACCCCGCAGG + Intronic
1145214770 17:21043124-21043146 CCCCCCCCCCCCCTCCCGGCCGG + Intronic
1145279430 17:21457100-21457122 CGGGCCCCGCCCCTCCCCGCAGG + Intergenic
1145398444 17:22513387-22513409 CTGGCCCCGCGCCTCCCCGCAGG - Intergenic
1145750006 17:27349046-27349068 CCGCCCGCGCCCCAGCGCGGCGG - Intergenic
1145878288 17:28335933-28335955 CCGCCCGCGCCTTTTCCCCCAGG - Intronic
1145998244 17:29116728-29116750 CCCCCCCCCCCCCCCCCCGCCGG + Intronic
1146022587 17:29292806-29292828 CCGCCCCCGCCCCTCACCCCAGG + Intronic
1146371009 17:32265782-32265804 CCGCCCGCGCGCCGCCCCCGAGG + Intergenic
1146896524 17:36545400-36545422 CCGCCCGCCCGCCCGCCCGCCGG - Intronic
1147137755 17:38443896-38443918 CCGCCTGCCCCCCGCCCCCCAGG - Intronic
1147163043 17:38578865-38578887 CAGGCCCCGCCCCTTCCCGCAGG - Intronic
1147168598 17:38605702-38605724 CCCCCCGCGCCCCCGCCCGATGG - Exonic
1147896551 17:43755316-43755338 CCGCCCGCGCCCCTCCCCACCGG - Exonic
1148048690 17:44759004-44759026 CCGGCCGCGGCCATCCCGGCGGG - Intergenic
1148391401 17:47275651-47275673 CAGCTCCCGCCCCTCCCCCCAGG - Intronic
1148559154 17:48596237-48596259 CCGCCCGCACAGCTCCCGGCGGG - Exonic
1148689620 17:49519834-49519856 ACCCCCACGCCCCTCCCCGCTGG - Intergenic
1148880253 17:50719866-50719888 GCGCCCGCTCCCCTCCCCCACGG - Intronic
1149293323 17:55238305-55238327 CCCGCCGCGCCCCTCTCCGCGGG + Intergenic
1149994351 17:61399194-61399216 CCGCCCGCGCCGGCCCCAGCAGG + Intergenic
1149994763 17:61400585-61400607 CCGCCCGCGCGCCTTCCAGCCGG - Intronic
1150373669 17:64662381-64662403 CCGGCCCCGCCCCGCCCCGCCGG - Intergenic
1150764635 17:67993577-67993599 CCGGCCGCGCGCCGCCGCGCTGG - Intronic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1151565271 17:74893944-74893966 CCACCCCCGCCCCGCCCCGAGGG + Intergenic
1152321575 17:79610936-79610958 CCTCGCGCGCCCCTTGCCGCTGG - Intergenic
1152408638 17:80111126-80111148 CCCCCCGCCCCTTTCCCCGCTGG - Intergenic
1152515646 17:80822294-80822316 CGGCCCGCGCCTCACCCCGGGGG - Exonic
1152729196 17:81961470-81961492 GCGCCGCCGCCCCCCCCCGCGGG + Intronic
1152730329 17:81966911-81966933 CATCCCGGGCCCCTCCCCCCAGG + Intergenic
1152750437 17:82060093-82060115 CTGCCCGCTGCCCTCCCCTCAGG - Exonic
1152793991 17:82298001-82298023 CCAGCCTCGCCCCTCCCGGCCGG - Intergenic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153489206 18:5630300-5630322 GCACCCGCGCCCCTGCCCACGGG + Intronic
1153805647 18:8706468-8706490 CTCGCCGCGCCCCTCGCCGCGGG + Intronic
1153872540 18:9334495-9334517 CCGCCCGCCCGCCGGCCCGCAGG - Intergenic
1154940886 18:21111730-21111752 CCCCCCTCGCCCCACCCCCCAGG - Exonic
1155654297 18:28176927-28176949 CCGCCCGTGGCCCGGCCCGCGGG + Intronic
1156036601 18:32772086-32772108 CCGCCCGCGCGCCGGCCCGCCGG + Exonic
1156230704 18:35151803-35151825 CCACAGCCGCCCCTCCCCGCAGG + Intergenic
1156449556 18:37259264-37259286 CCACCCCCTCCCCTCACCGCAGG - Exonic
1157833650 18:50879316-50879338 CCGCCCGGGCCCCACCGCGCCGG - Intronic
1158282285 18:55840836-55840858 CGTCCCGAGCCCTTCCCCGCAGG + Intergenic
1159109837 18:64043245-64043267 CCACCCCCTCCCCTCCCCGTGGG + Intergenic
1160452459 18:78974551-78974573 CGGCGTGCGCCCCTCTCCGCCGG + Intergenic
1160465147 18:79069699-79069721 CTGCCCGCGGCCCTCACCACCGG - Intronic
1160539773 18:79614230-79614252 CCCCTGGCGCCCCTCCCTGCAGG - Intergenic
1160551633 18:79697189-79697211 CCTCCCGTGCCCATCCCCGAAGG - Intronic
1160668344 19:344266-344288 CCGCCCGCGAGCCCCCCGGCGGG - Intronic
1160752332 19:740293-740315 CCGCCCCCGCACCCCCCCGCCGG - Intronic
1160762291 19:791728-791750 CCCCCCTCCCCCCTCCCCCCGGG - Intergenic
1160781710 19:880377-880399 CCCTCCCCGCCCCTCCCAGCTGG + Intronic
1160789738 19:917931-917953 CCGCCCGGGCCCGCCCGCGCTGG - Intronic
1160792570 19:929429-929451 CGGCCGGGCCCCCTCCCCGCAGG + Exonic
1160793441 19:933338-933360 CCGCCCCAGCCTTTCCCCGCAGG + Intronic
1160810543 19:1011195-1011217 ACGCCCTCACCCCGCCCCGCAGG - Exonic
1160818849 19:1048873-1048895 TAACCCGCGCCCCTCCCCGCAGG + Exonic
1160823337 19:1068152-1068174 CCCCTCCCGCGCCTCCCCGCAGG + Intronic
1160826460 19:1082595-1082617 CCACGCGCGCCCCGCCCTGCAGG - Intronic
1160863845 19:1248843-1248865 CAGCCCCCGCCCCGCCCCCCGGG + Intronic
1160873092 19:1285874-1285896 GAGCCCGGGCCCCTCCCCGGCGG + Intergenic
1160887052 19:1354975-1354997 CCGCCGCCGCCGCTCCCCGCGGG - Intronic
1160904554 19:1446180-1446202 CCTCCCGCCCCTCTCCGCGCAGG + Intergenic
1160952850 19:1675868-1675890 CCTCACGGCCCCCTCCCCGCCGG + Intergenic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1160990974 19:1860187-1860209 CCGCCCCCGCCCCAACTCGCTGG + Intronic
1161029411 19:2050892-2050914 CCGCCCTCGGGCCTCCCCCCGGG - Exonic
1161114590 19:2489405-2489427 CCGCCCGCCCCACGCCCCGGCGG + Intergenic
1161157466 19:2740059-2740081 CCGCCCACGCCCCTGCCCATTGG + Exonic
1161702698 19:5804172-5804194 CCACCCGGGCTCCTCCCCGACGG - Intergenic
1161703059 19:5805313-5805335 CCGCCCGCGGCCGCCCCCTCCGG + Intergenic
1162070396 19:8149233-8149255 CCGGCCGAGCCCCTCCCGCCGGG + Intronic
1162315539 19:9936273-9936295 CCGCGCCCGCACCTGCCCGCCGG + Intronic
1162334404 19:10051604-10051626 CCGCCCCCCCCCCCCCCCCCCGG + Intergenic
1162426869 19:10602414-10602436 CCGGCCCCGCCCCTCCCGCCGGG - Intergenic
1162437564 19:10671388-10671410 CCACCCGCATCACTCCCCGCAGG - Exonic
1162486038 19:10961120-10961142 CCTCCCCCGCCCCTCCGCGCGGG - Exonic
1162954264 19:14089824-14089846 CCGTCCGGGCCTGTCCCCGCGGG + Exonic
1162959623 19:14118096-14118118 CCTCCGCCGCCCCGCCCCGCCGG - Intergenic
1163146213 19:15380430-15380452 GTGTCCGCGCCCCTCCCCACAGG - Exonic
1163233632 19:16019259-16019281 CCCCCCACGCCCCTCCCTGTAGG - Intergenic
1163440366 19:17319735-17319757 CCGCCCGCCCGCCTCCCTGCCGG + Exonic
1163441329 19:17323919-17323941 CCGCCCCCGCCGGACCCCGCCGG + Intronic
1163508022 19:17719687-17719709 CCGCCGCCGCCCCACCCCGCCGG - Intronic
1163591183 19:18194936-18194958 CATCCCCCGCCTCTCCCCGCAGG + Exonic
1163715318 19:18869572-18869594 CCCCCCCCGCCGCACCCCGCAGG - Intronic
1163774922 19:19212301-19212323 CAGCCCGGCCCCCTCCCCACCGG - Intronic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164693640 19:30227889-30227911 CTTCCCGCGCCCATCCCCGCCGG - Intergenic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1165166235 19:33859168-33859190 CTGCCCGCGCGCCTCCCCCGTGG + Intergenic
1165293177 19:34905393-34905415 CCGGCCCCGCCACGCCCCGCAGG + Intergenic
1165495871 19:36151755-36151777 CCGCCCACCTCCCACCCCGCAGG - Exonic
1165856303 19:38880897-38880919 AAGCTCACGCCCCTCCCCGCAGG - Exonic
1165884101 19:39064951-39064973 CCGCCCGCCCCCCACCCCCAGGG - Intergenic
1166073040 19:40397707-40397729 CCGCCGCCGCTCCTCCCCCCAGG - Exonic
1166250379 19:41565328-41565350 CCGCCCCCGCCCCTTCCCCAAGG - Intronic
1166857881 19:45792389-45792411 CCCCCCGAGCCCAGCCCCGCGGG + Exonic
1167036138 19:46995995-46996017 TCGCCTGCTCCCCTCCCCACTGG - Intronic
1167074465 19:47240202-47240224 TCCCCCGCTCCCCGCCCCGCAGG + Intergenic
1167075163 19:47244123-47244145 TCGTCCTCGCCCCTCCCCTCCGG + Intergenic
1167601795 19:50459089-50459111 CCGCCCCGCCCTCTCCCCGCAGG + Exonic
1167649113 19:50719850-50719872 CCGCCCTCTCCCCTCCCTCCGGG + Intergenic
1167688306 19:50969724-50969746 CCGCCCTCCCGCCTGCCCGCCGG - Intergenic
1168153454 19:54460933-54460955 CTGCCCCCGCCCCTCCTCGCTGG - Exonic
1168258410 19:55179581-55179603 CTGCCCGCTCCCCACCTCGCGGG - Intronic
1168324253 19:55530070-55530092 GCGCCCCCGCCGCTCCCCGAGGG - Exonic
1168339079 19:55613631-55613653 CCCCCGGCGCCGCTGCCCGCTGG - Exonic
925068812 2:950746-950768 CCGCTCGCCGCCCTCCCCGCGGG + Intergenic
925984747 2:9206758-9206780 CCGGACCCGCCCCTCTCCGCGGG + Exonic
926251313 2:11156768-11156790 CCCCCCCCTCCCCACCCCGCAGG - Intronic
926268184 2:11344680-11344702 CCGCCGGCGCGCGTCCCCGCCGG + Intronic
926874296 2:17457776-17457798 CACCCCCCGCCCCTCCCTGCGGG + Intergenic
927988340 2:27429031-27429053 CCGCCCCCGCCCCCACCCGCCGG - Intronic
928511932 2:32010600-32010622 CGGCCCCCTCCCCTCCCAGCTGG + Intronic
929107203 2:38377000-38377022 CCGCCGCCGCGCCTGCCCGCCGG - Intronic
929450361 2:42032877-42032899 CCGCCCCCGCCCCCACCCCCGGG - Intergenic
929604182 2:43224545-43224567 CCCAGCGCGACCCTCCCCGCCGG - Exonic
929808572 2:45169563-45169585 CCGTCCCCGCCCGTCTCCGCGGG - Intergenic
931671753 2:64653976-64653998 CCGCCCGACCCCGCCCCCGCCGG + Intronic
932234348 2:70109070-70109092 CCACCCAGGCCCCGCCCCGCTGG - Intergenic
932342998 2:70978577-70978599 CCGCCGGCGCCCCGCCCCCGGGG - Intronic
932893194 2:75613343-75613365 CCCCCCCCCCCCCCCCCCGCAGG - Intergenic
933684593 2:85133388-85133410 CCCCGCTCGCCCCTCCCCGGCGG + Exonic
933789961 2:85875926-85875948 CCGCCTGCTCCCCTCCCCACAGG + Intronic
934479506 2:94622291-94622313 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
934670335 2:96208480-96208502 CCGCCTGCGCCCCTCCGGACTGG - Exonic
934966878 2:98731172-98731194 CCCGCCCCGCCCCGCCCCGCCGG + Intergenic
934978344 2:98821925-98821947 CAGCCCGCGCCCCCCGACGCCGG - Exonic
935196678 2:100820371-100820393 CAGTCCGCGCCCGGCCCCGCGGG + Exonic
935301493 2:101697487-101697509 CGGCCCGCGCCCTACCCGGCAGG + Intronic
935602589 2:104938330-104938352 CCTCCCGCACCCCTCCCAGTTGG - Intergenic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
937951080 2:127388188-127388210 CCGCCCCCGCCCCTGCCCCGGGG + Intronic
938338896 2:130522730-130522752 CGGCCCGTGGCCCTCCCCGCAGG - Intronic
938350942 2:130598020-130598042 CGGCCCGTGGCCCTCCCCGCAGG + Intronic
939178672 2:138780451-138780473 CCCCGCGCGCCCCTCCTCGGAGG + Intergenic
942178143 2:173354817-173354839 CAGCCCGAGCCCCGCCCCTCCGG + Intronic
942454596 2:176129536-176129558 CCGCCGCGGCCCCTCCCTGCCGG + Intergenic
942947152 2:181683724-181683746 CCTCCCGCCCCCCTTCCCGCGGG - Intergenic
943669788 2:190648852-190648874 CCGCCCCCGCCCCCGCCCGGCGG + Intronic
945032931 2:205682208-205682230 GCCCCCGCGCACCTCCGCGCCGG - Intronic
945189022 2:207166917-207166939 CAGTCCCCGCCCCGCCCCGCGGG + Intronic
945833121 2:214809698-214809720 CCCCGCGCGCCCCGCCCCTCTGG - Exonic
946325393 2:218982256-218982278 CTGACCGCCCCCCTCCCCACAGG - Exonic
947399126 2:229714593-229714615 CCCGCCCCGCCCCGCCCCGCAGG - Intergenic
947754317 2:232550789-232550811 TCCCCCGCGCCCGCCCCCGCTGG + Intronic
948738345 2:240025493-240025515 CGGCCCTCGCCCCAACCCGCAGG - Intergenic
948801713 2:240436186-240436208 CCGCCTGCGCCCCGCCGCCCGGG + Intronic
948875161 2:240822601-240822623 CTGCCCGCCCCGCTCCCTGCAGG - Intergenic
948910294 2:240999221-240999243 CCGCCCGCGCGCCTCTCCCGCGG - Intronic
949004374 2:241637068-241637090 CCGCCCGCGGACCGCCCCGAGGG + Exonic
949027658 2:241774007-241774029 CCTGCCTCGCCCCTCCCCACAGG + Intergenic
949036216 2:241816775-241816797 CCGCCTGAGCCAGTCCCCGCTGG + Exonic
949045402 2:241870463-241870485 TGCCCCGCGCCCCTCCCAGCTGG - Intronic
1168806649 20:675691-675713 CCTCCCGCGCTCCAGCCCGCTGG - Exonic
1169048791 20:2559031-2559053 CCACCCGCGCCCCGCCTCACCGG - Intronic
1170578476 20:17681542-17681564 CCGCCCGCACCCCACCCCTCCGG + Intronic
1171974847 20:31587901-31587923 GCGCCCTCGCCCCCGCCCGCCGG + Intergenic
1172037317 20:32019154-32019176 ACGCCCGCGCCCCGGCGCGCTGG - Exonic
1172274986 20:33674469-33674491 CCGCCCCCGCCCCGCCCCCGCGG + Intergenic
1172421875 20:34825233-34825255 CCTCCAGCGCCCCCGCCCGCAGG + Intronic
1172422020 20:34825635-34825657 CGGCCCATCCCCCTCCCCGCCGG - Intronic
1173494333 20:43507865-43507887 CAGCCCGCGCCCCCCGCCGGAGG - Intronic
1174053995 20:47785678-47785700 CCCCCCGCTCGCCTGCCCGCCGG + Intronic
1174182551 20:48683943-48683965 ATGCCAGCGCCCCTCCCCACTGG - Intronic
1175349886 20:58310029-58310051 CCTCCCGTGGCCCTCCCGGCCGG - Intronic
1175974393 20:62703134-62703156 ACGCCCTCCTCCCTCCCCGCTGG + Intergenic
1175992509 20:62796716-62796738 CAGGCCCCGCCCCGCCCCGCCGG - Intronic
1175994261 20:62805194-62805216 CGGCCCCCGCACTTCCCCGCCGG - Intronic
1176061578 20:63175067-63175089 CCTCCCGCTCCCGCCCCCGCCGG + Intergenic
1176148047 20:63574146-63574168 GCGCCCCCGCCCCTCCGCCCTGG + Intronic
1176194458 20:63830950-63830972 CCCGCCACGCCCCGCCCCGCGGG - Intronic
1176207141 20:63895289-63895311 CCGCCCGCCCGCCCTCCCGCCGG - Exonic
1176241973 20:64079551-64079573 CCGCCCCGGCCCCTCCTCACCGG + Intronic
1176414616 21:6467538-6467560 CCGCCTGCTCCCCTCGCCGTGGG - Intergenic
1176549986 21:8216953-8216975 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1176568912 21:8399987-8400009 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1176576826 21:8444222-8444244 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1178839895 21:36130114-36130136 CGGCCCCCTCCCCTCCCAGCTGG - Intergenic
1179209473 21:39313330-39313352 CGTCCCCCTCCCCTCCCCGCCGG - Intronic
1179496952 21:41778181-41778203 CCGCCTGCGCCCCCCGCCGGGGG + Intergenic
1179522480 21:41954050-41954072 CCGGCCGCGCCCCCTCCCTCGGG - Intergenic
1179690114 21:43075860-43075882 CCGCCTGCTCCCCTCGCCGTGGG - Exonic
1179882791 21:44300422-44300444 CCGCCCGCGCCCTGCCCCGGGGG + Intronic
1180075472 21:45459441-45459463 CCTCCAGCTCCCCTCCCCTCAGG - Intronic
1180232627 21:46436471-46436493 CCCCCCCCCCCCCCCCCCGCTGG + Intronic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1180650213 22:17370303-17370325 CCCCCCGCGCCCGGCCCCGCCGG - Intronic
1180748838 22:18110829-18110851 TCGCCCGCGCACCTCTCAGCTGG - Exonic
1181032462 22:20155078-20155100 ACGCCCCCGCCCCTCTCCCCGGG + Intergenic
1181082941 22:20426116-20426138 CCCTCCGGGCCCCTCCACGCTGG + Exonic
1181094286 22:20495393-20495415 CTGGCCGCGACCCTCCGCGCTGG - Intronic
1181440884 22:22934721-22934743 CCACGCGGGCCCCTCCACGCAGG - Intergenic
1182084060 22:27549404-27549426 CCGCCCAGGCCCCTCCTCACAGG - Intergenic
1182254754 22:29030603-29030625 CCGGCCGCGCCCCTCCCCACCGG - Intronic
1183293865 22:37018934-37018956 CCGGCCCCGCCCCTCCCAGCCGG + Exonic
1183358936 22:37373472-37373494 CTGCCCCCGCCGCTGCCCGCCGG + Exonic
1183486394 22:38089469-38089491 GCGCCCCCGCCGCCCCCCGCGGG - Intronic
1183545998 22:38455183-38455205 CGTCCCGCGCCGCTCCCCGCGGG + Exonic
1183547404 22:38461824-38461846 ACGCCCCCACCCCTCGCCGCTGG - Intergenic
1183577976 22:38704378-38704400 CCGCCCCCCCCCCCCCCCCCCGG + Intergenic
1184098025 22:42327108-42327130 CCGCCCCCTCCCCTCCAAGCTGG - Intronic
1184421837 22:44386690-44386712 CAGCCCGCATCCCTCACCGCTGG + Intergenic
1184589280 22:45470847-45470869 CCCCCCTCCCCCCTCCCCGCTGG + Intergenic
1184698019 22:46150540-46150562 CCGCCCGCTGCCCCCGCCGCGGG - Intronic
1185229543 22:49672277-49672299 CCCCCCGCCCCCACCCCCGCTGG - Intergenic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1185313908 22:50170648-50170670 CCGCCCGCGCCCCCCTCGCCGGG + Intergenic
1185385645 22:50530314-50530336 ACGCTCGGGCCCCGCCCCGCTGG + Intronic
1185389143 22:50549454-50549476 CCACGCGCGCCACTCCCCGCAGG + Exonic
1203254876 22_KI270733v1_random:133279-133301 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1203262025 22_KI270733v1_random:175127-175149 GCGCCCCCGCGCCGCCCCGCCGG - Intergenic
1203262932 22_KI270733v1_random:178358-178380 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
949999994 3:9649439-9649461 CCGGCCCCGCCCCGTCCCGCCGG - Intronic
951630655 3:24716520-24716542 CCCCCCGCCCCCCTCCCCACTGG - Intergenic
952905835 3:38138611-38138633 CGGCACCCGCCCCGCCCCGCCGG - Exonic
953031226 3:39181063-39181085 CCGCCCCCGCCCCTCCTCGGCGG + Intergenic
954146593 3:48637467-48637489 AGGCCCGAGCCCCTCCCCGTGGG + Exonic
954615540 3:51967311-51967333 CGGCCCGCGCCCTACCTCGCTGG + Exonic
954632926 3:52056654-52056676 CCTCCACCGCCCCTCCCCACGGG + Intergenic
954674868 3:52310314-52310336 CAGCCCCAGCCCCTCCCCTCTGG + Intergenic
954717540 3:52533928-52533950 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
954747453 3:52795224-52795246 CTGCCCCCGCCACACCCCGCAGG - Intronic
954797841 3:53170506-53170528 CCGCCCGCCCACCTGCCTGCAGG - Intronic
955081360 3:55660460-55660482 CCACCCCCGCCCCACCCCCCAGG - Intronic
956432409 3:69200470-69200492 CCGCCCTCCCCCCTCCCAGACGG + Intronic
956765779 3:72483054-72483076 CCGCCCCCACCCCTCACCTCGGG - Intergenic
959078932 3:101779606-101779628 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
959085713 3:101849324-101849346 CCGCCCTCGCCCCGCCCGCCCGG - Intronic
960223728 3:115146915-115146937 CCTCCCTCCCACCTCCCCGCCGG + Intronic
960925917 3:122795014-122795036 CCGCCTCCCCGCCTCCCCGCCGG + Exonic
961453702 3:127014130-127014152 CCGCCCACTGCCCACCCCGCCGG - Intronic
961574497 3:127823325-127823347 GCGCCCCCGCTCCTCCCCGCGGG - Intergenic
961652993 3:128426563-128426585 CCGCCCGCGCTGCGCCTCGCCGG - Intergenic
961665089 3:128489513-128489535 CCTCCCGCTCCCCTCCACGCTGG + Intronic
961868935 3:129974620-129974642 CCGTCAGCGCCCCTTCCCGGCGG + Exonic
962164837 3:133038315-133038337 CCGCGCGCGCCCCTCCGACCAGG - Intergenic
962891740 3:139678069-139678091 CTGCCCCCGCCCCCGCCCGCTGG + Intergenic
963335599 3:143971403-143971425 CCGGCCTCGCCCCACCCCCCAGG + Intergenic
964790379 3:160449416-160449438 CCGCCCGTCCCCAACCCCGCGGG + Intronic
965590559 3:170357377-170357399 GCGCGCGTGCCCCTCCCCCCAGG - Intergenic
966919910 3:184604515-184604537 CCACCCTCGCCCGGCCCCGCCGG - Intronic
967762434 3:193241117-193241139 CCGCCCGCCCGCCCGCCCGCCGG - Exonic
967859615 3:194141324-194141346 CCGCCCGGGGCCCTCCGCCCGGG + Intergenic
967859699 3:194141578-194141600 CCGCCCGCCCGCCCGCCCGCCGG - Intergenic
968293449 3:197555866-197555888 CCCCCCTCGGCTCTCCCCGCAGG - Exonic
968341572 3:197960172-197960194 CCGGCCCCGCCCCTCGCCGCTGG - Intergenic
968457164 4:705736-705758 CCGCCCACGCCCCTTGCCGCGGG + Intronic
968651361 4:1761479-1761501 CCCCGCGCGCCCCACCCAGCCGG + Intergenic
968729255 4:2261985-2262007 CCGCCCGCGCCCGTCCGCCCCGG + Exonic
968809323 4:2792971-2792993 CCGGCCCCGCCCCTCCCCGGCGG - Intergenic
969113950 4:4859969-4859991 TGGCCCGCGCCTCCCCCCGCCGG - Exonic
969239200 4:5888194-5888216 CCGCCCCCGCCGCCCCGCGCTGG - Intronic
969271356 4:6105443-6105465 CCGCCCCCTCCCCCGCCCGCGGG - Intronic
973197676 4:47463732-47463754 GGGTCCACGCCCCTCCCCGCCGG - Intergenic
973954491 4:56049363-56049385 CCACTCGCGCCCCTCCGGGCCGG + Intergenic
975612199 4:76213960-76213982 CGGCCCGCGCCCTCCCCGGCCGG + Intergenic
978189405 4:105895384-105895406 CCCCTGGCGCCCCTCCCCGCGGG + Intronic
979033198 4:115678583-115678605 ATGCCCGAGCCCCTCCCCACCGG - Intergenic
981782782 4:148445229-148445251 CAGCCCTCGCCTCCCCCCGCAGG - Intergenic
983238615 4:165207386-165207408 CCGCCCGCGTCCCGGCCTGCGGG + Intronic
983249286 4:165326892-165326914 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
983649695 4:170026189-170026211 CCACCCGTGCCCCTCCGCCCCGG + Intronic
984966390 4:185143613-185143635 CCGCCCGCCCGCCCGCCCGCGGG + Intronic
985632521 5:1021420-1021442 CCCCCCCAGCCCCTCCCCACAGG + Intronic
985650413 5:1104911-1104933 CAGCACACGCCCCTCCCCGCAGG + Intronic
985791593 5:1931145-1931167 CCGCCCCCGTGCCTCTCCGCAGG + Intergenic
985894562 5:2740686-2740708 CGGCCCACGTCCTTCCCCGCAGG - Intergenic
985896293 5:2751562-2751584 CCGCCGCCGCCCCGGCCCGCGGG - Exonic
987193231 5:15500323-15500345 CCGCCCGCCCCGATCCCCTCCGG - Exonic
989043152 5:37249427-37249449 CCGCCCGCGGCGTTCCCGGCCGG - Exonic
989276830 5:39599081-39599103 TGGCACCCGCCCCTCCCCGCGGG + Intergenic
990075581 5:51842927-51842949 CCCCCCCCCCCCCCCCCCGCAGG + Intergenic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
992627661 5:78649156-78649178 CCGCCTCCGGCCCTCCCGGCAGG - Intronic
996900585 5:128538278-128538300 CGGCCCGCCCCGCGCCCCGCCGG - Intronic
997013338 5:129904387-129904409 CCTCCCGCTCCCCCCGCCGCCGG - Intergenic
997297533 5:132777303-132777325 CCGCCCCTGCCCCCGCCCGCGGG + Exonic
997319179 5:132963691-132963713 GCCTCTGCGCCCCTCCCCGCTGG + Intergenic
997417516 5:133740457-133740479 CCGCCCCCACTCCTCACCGCAGG + Intergenic
998157731 5:139795997-139796019 CGGGACCCGCCCCTCCCCGCTGG + Intronic
999435621 5:151561244-151561266 CAGTCCGGGCCCCTCCACGCAGG - Intronic
1000358260 5:160421934-160421956 CAGCCCGCCTCCTTCCCCGCCGG - Exonic
1001035127 5:168291932-168291954 CCGCCCGCTCCTCCCGCCGCCGG - Intronic
1001159743 5:169302068-169302090 ACGCACACGCCCCTCCCCACTGG - Intergenic
1002006415 5:176238354-176238376 CGCCCCGAGCCCCGCCCCGCCGG - Exonic
1002173419 5:177387868-177387890 CCCCCAGCCCCCCTCACCGCCGG - Exonic
1002184228 5:177446862-177446884 CCGCCGCCGCCTCCCCCCGCAGG + Exonic
1002219965 5:177672283-177672305 CGCCCCGAGCCCCGCCCCGCCGG + Intergenic
1002429438 5:179194500-179194522 CCACACCCGCCTCTCCCCGCAGG - Intronic
1002591003 5:180291777-180291799 CCCTCACCGCCCCTCCCCGCGGG + Intronic
1002610134 5:180412228-180412250 CCCGCCCCGCCCCGCCCCGCCGG - Intergenic
1002896220 6:1382030-1382052 CCTCCCTCTCCCCTCCGCGCGGG - Intergenic
1003078040 6:2999757-2999779 CCGCCCACTCCCCGCCCCGGCGG - Intronic
1003426064 6:5999271-5999293 GCGCCCCTGCGCCTCCCCGCTGG + Intronic
1004924480 6:20403721-20403743 CCGCCCTCGCCCTGCGCCGCCGG + Intronic
1005472112 6:26171858-26171880 CCGGTCGTGCCCCTCCACGCAGG + Intergenic
1005965101 6:30721419-30721441 GCGCCCCGGCCCCGCCCCGCAGG - Intronic
1006028449 6:31162090-31162112 CCTCCCGTGCCCATCCCCCCAGG - Intronic
1006933115 6:37699106-37699128 CAGCCTACGCCCCTCCCCGCGGG - Intronic
1007424022 6:41735375-41735397 CCGCCCGCGCCCCGCGGCTCCGG + Intronic
1007680229 6:43628848-43628870 CCTCCCGTGCCCCTCCTCCCTGG + Intronic
1007701777 6:43770118-43770140 CCGCCCCCGGCCCGCCCCGGGGG - Intergenic
1007739508 6:44002270-44002292 GCGCCCACGCCCTCCCCCGCGGG + Intronic
1007785107 6:44275381-44275403 CCGCCTGCCCCCCGCGCCGCAGG + Exonic
1007844054 6:44739368-44739390 CCGGCCGCCACCCTGCCCGCGGG - Intergenic
1010244800 6:73653514-73653536 CCGCCCCCGCCCCCGCCCGGTGG + Intronic
1010703238 6:79077569-79077591 CCGCCCGCCCCGCGCCCCGGCGG + Intronic
1010703479 6:79078424-79078446 CCCCACCCGCTCCTCCCCGCAGG + Intergenic
1011099741 6:83708574-83708596 TCGCCCGGGCCCCTTCCCCCCGG + Intronic
1011434531 6:87322670-87322692 CCGCCCTGGCCCCTCCAGGCCGG - Intronic
1012211278 6:96521716-96521738 CCGCCCGCCCCCCGCGCCTCGGG + Intronic
1013391681 6:109691511-109691533 CCGCCTGCGCCCCGCCGCGAGGG - Intronic
1015244557 6:131062676-131062698 GCGGCCGACCCCCTCCCCGCGGG + Intronic
1015251920 6:131135798-131135820 TCGCCCCCGCCCCGGCCCGCTGG - Intronic
1016272083 6:142301598-142301620 CCGCCCTGTCCCCTCCCAGCTGG + Intergenic
1016329888 6:142945206-142945228 CCGCGCGGCCCCCTCCCCCCAGG + Intergenic
1016965766 6:149717759-149717781 GGGCCCACGCCCATCCCCGCTGG - Intronic
1018719769 6:166563573-166563595 CCGCCCTCTCCCCTCCACACAGG + Intronic
1018769282 6:166957222-166957244 CCTCACCTGCCCCTCCCCGCGGG + Intergenic
1018945517 6:168345212-168345234 CCGCACGCCCCTCTCCCCGCAGG - Intergenic
1018984359 6:168625085-168625107 CCGCCCCCGCCCTTCCTCCCAGG + Intronic
1019360344 7:601612-601634 CCGGCCCCGCCCGGCCCCGCCGG + Intronic
1019379160 7:712306-712328 CCGCGCGCCCCACTCCCGGCGGG + Intronic
1019379253 7:712592-712614 CCCCCCGACCGCCTCCCCGCGGG + Intronic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1019725240 7:2598529-2598551 CCGCGGGAGCCCCTCCTCGCTGG - Exonic
1020099863 7:5388760-5388782 CCCCCCGCGGCCACCCCCGCCGG - Exonic
1020278290 7:6637467-6637489 CCGCCCGCGCCGCCGCCCACCGG - Intronic
1021776539 7:24059930-24059952 CCGCCGCCACCCCTCCCCGCAGG - Intergenic
1022207808 7:28180357-28180379 CCTGCCGCCTCCCTCCCCGCCGG + Intronic
1023967374 7:44969963-44969985 CAGCCCGGGCCCCTCCCCATGGG + Intronic
1023972113 7:44999652-44999674 CCGGCCGCGTCCCCTCCCGCCGG + Intronic
1024043827 7:45574474-45574496 CCGCCCGCGCCCCGGCGCCCCGG + Intronic
1025106306 7:56174598-56174620 CCTCACCTGCCCCTCCCCGCTGG - Intergenic
1026132353 7:67630969-67630991 CTCCCCGCATCCCTCCCCGCAGG + Intergenic
1026968202 7:74453643-74453665 GCGCCACCGCCCCTCCCCGCAGG + Intergenic
1028622186 7:92836653-92836675 CCGCCCGCGCCGCTCGCTGGGGG + Intergenic
1028830775 7:95324575-95324597 CCCGCCCCGCCCCTCCCCGCCGG + Exonic
1029110558 7:98211378-98211400 CCGCCCCGGCCCCGCCCCGAGGG + Intergenic
1029414736 7:100435831-100435853 CCGCCCGCCCCCCTCACCCTCGG + Exonic
1029483837 7:100827543-100827565 CCCCGCGCGCCCCTCCCTCCCGG - Intronic
1030033310 7:105388474-105388496 CCGCCGCCGCCCCTCCCCCCGGG + Intronic
1030820712 7:114087556-114087578 CTGCCCGCCCGCCTGCCCGCCGG - Intronic
1032186409 7:129730609-129730631 CCGCCCGCGCCACTTCCCAATGG - Intronic
1032819335 7:135510131-135510153 CCTCCCCCGCCCCTCCTGGCCGG - Intergenic
1033033261 7:137846944-137846966 CCTCCCGCGCCCTCCCGCGCCGG + Intronic
1033167384 7:139052274-139052296 CCCCCCACCCCCCTCCCCTCTGG + Intronic
1033214527 7:139483750-139483772 CAGGCCACGCCCCTCCCCGAAGG + Intergenic
1033339211 7:140479053-140479075 CCTCCCGCGCCTCTAGCCGCAGG + Intronic
1033406366 7:141074003-141074025 CCGCCCCCTCCCCGCCCCGCAGG - Intergenic
1034188312 7:149195789-149195811 CAGCCCGCGCCCCGCCCCCACGG - Intronic
1034254067 7:149714911-149714933 CCACCCCCGCCCCTCCCCCTCGG + Intronic
1034264084 7:149772992-149773014 CCGTCCGCGCCCCTACCCCCGGG + Intronic
1034439737 7:151080650-151080672 CCTCCCGCAGCCCTCCCCGCAGG + Intronic
1034447302 7:151120213-151120235 CTGCCCACGCCCCTCCTGGCTGG - Intronic
1034617912 7:152435503-152435525 CCGCCCCGCCCCCACCCCGCCGG + Intronic
1034618280 7:152436685-152436707 CCGCCCCTCCCCCTCCCCCCCGG + Intergenic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1034849419 7:154480017-154480039 CCGCCCCTGCCCCGCCCCACAGG + Intronic
1034963000 7:155374055-155374077 CCGCCCTCGGGCCTCCGCGCCGG - Intergenic
1035601162 8:897685-897707 CCGCCCCTCCCCCTCCCCACGGG + Intergenic
1035751866 8:2002099-2002121 CTGCCCGCGCGCTCCCCCGCCGG - Exonic
1036688021 8:10924600-10924622 CCGGCCGCGCCCCGCCACCCCGG - Intronic
1037819868 8:22130438-22130460 CCGCCCGCGCCGCGACCGGCCGG - Exonic
1038256352 8:25954690-25954712 CCGCCCCCGCCCCTTCCCCCAGG + Intronic
1038296130 8:26291956-26291978 CCGCCCCCACCCCACCCCTCTGG - Intronic
1038575812 8:28702182-28702204 TCGCCTGCTGCCCTCCCCGCTGG + Intronic
1039484405 8:37899622-37899644 CCCGCCCCGCCCCGCCCCGCCGG + Intergenic
1039595679 8:38788030-38788052 CAGCCCCCGCCCCTCCACACTGG + Intronic
1042611664 8:70607787-70607809 CCGCCGCCGCCCCCTCCCGCAGG - Intronic
1043388154 8:79768013-79768035 CCGCGCCCGCCCCTGCCCGGCGG + Intergenic
1043502978 8:80874388-80874410 CCGCGCGCGCCTCTCCCGGCCGG + Intronic
1044229426 8:89757662-89757684 CCGCTCGCGGCCCTCCCGCCTGG - Intergenic
1044242388 8:89902479-89902501 GCGCGCGGGCCCCTCCTCGCAGG - Intronic
1045443616 8:102239003-102239025 CCGGCCCCGCCCCGCCGCGCCGG + Exonic
1045488661 8:102654286-102654308 GCAGCCCCGCCCCTCCCCGCGGG - Intronic
1045489204 8:102656132-102656154 CCGCCCCGTCCCCTCCGCGCCGG + Intergenic
1048554035 8:135457774-135457796 CCGCCCGCGCCCCCAGCGGCGGG - Exonic
1049090717 8:140511682-140511704 CCCCTCGCGCCCCGCCCCGCCGG + Intronic
1049396334 8:142402923-142402945 CCGCCCCCTCCCCTCCCCACCGG + Intronic
1049424819 8:142533247-142533269 CCGCCCCCGCCCCTGCCCCCAGG - Intronic
1049557337 8:143289555-143289577 CCGCCCGGGCCTCTCCCCGCTGG - Intergenic
1049643515 8:143726107-143726129 CCGATCGCGCTCCTCCGCGCTGG + Exonic
1049651319 8:143771243-143771265 CCTCCCCCGCCCCACGCCGCCGG - Intergenic
1049663045 8:143829042-143829064 AGGCCCCCGCCCCGCCCCGCCGG + Intronic
1049771909 8:144386756-144386778 CCTCCCGCTCCCATCCCCGTGGG + Intronic
1049843200 8:144787244-144787266 CCCCGCGCGCCCGCCCCCGCCGG + Intronic
1049850173 8:144826665-144826687 CCTGACGCGCCCCTCCCCACGGG - Intergenic
1050459400 9:5864515-5864537 CCGCTCGCCCCCCTCCCCACGGG - Intergenic
1050874023 9:10613108-10613130 CCGCCCCGGCCCCCGCCCGCCGG - Intergenic
1051404941 9:16727116-16727138 CCGCCCGCCCGCCGGCCCGCCGG - Intronic
1051896521 9:21994605-21994627 CCGCGCGCGCGCCTCCCTACGGG - Intronic
1053067639 9:35079599-35079621 GTGCCCAGGCCCCTCCCCGCTGG - Exonic
1053114528 9:35489822-35489844 CGGCCCGCGCCCGCCCCCGCGGG - Intergenic
1053306117 9:36986020-36986042 CCGGCCTCGCCCCTCCAGGCCGG + Intronic
1053352854 9:37424778-37424800 CTGTCCCCGCCCCTCCCAGCTGG - Intronic
1053678324 9:40461290-40461312 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054285403 9:63163658-63163680 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
1054291401 9:63296827-63296849 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054389417 9:64601365-64601387 CCGCCCGCGCCTTCCCCCGTGGG + Intergenic
1054506296 9:65915005-65915027 CCGCCCGCGCCTTCCCCCGTGGG - Intergenic
1054782188 9:69175337-69175359 CCTCCCTCCCTCCTCCCCGCTGG - Intronic
1055497169 9:76867204-76867226 CCGCCCCCGCCCCCGCCAGCAGG + Intronic
1057227608 9:93300787-93300809 CCTCCCCAGCCCCTCCCCACTGG + Intronic
1057466255 9:95317268-95317290 CCGCCCTGGCCCCGCCCCGCGGG + Intronic
1057802880 9:98200552-98200574 CCGCCCCCCCACCACCCCGCCGG - Intronic
1057997121 9:99828640-99828662 CCCCCCGCGCCCAGCCCGGCCGG + Exonic
1058662965 9:107283224-107283246 CCGCCCGGCCCCATCCCCCCAGG + Intronic
1058885795 9:109320554-109320576 CCGCCCGCGCCGCCTCTCGCGGG + Exonic
1058908124 9:109497993-109498015 CCGCCCGCGCCCTCCCGCCCCGG + Intronic
1060113206 9:120921082-120921104 CAGCCCCCTCCCCTCCCTGCTGG - Intronic
1060596820 9:124853503-124853525 CCGGCCCCGCCCCGCCCCGGCGG - Exonic
1060757232 9:126222896-126222918 CCCCCCGCCCCCTACCCCGCTGG + Intergenic
1060825145 9:126683457-126683479 CCGCCCGGCCTCCTCCCTGCCGG - Intronic
1060849173 9:126860624-126860646 CAGCCCGCGCCCCCCGCCCCCGG - Intergenic
1060917042 9:127397732-127397754 CAGCCCCCACCCCTCCCCTCGGG + Intronic
1061073002 9:128323154-128323176 CCGCCCGCGCCTCGCCCCCGTGG + Intronic
1061123125 9:128656504-128656526 CCGCCCGCGTCGCTCCGCGCGGG + Intronic
1061366023 9:130172778-130172800 CCGCCCCCGCCCCCGCCCCCCGG + Intronic
1062043948 9:134416642-134416664 CCTCCCCCGCCCCCCGCCGCAGG + Intronic
1062087305 9:134655364-134655386 CCGCCCTCCACCCTCCCGGCTGG - Intronic
1062332440 9:136050702-136050724 CCTCCCCCGCCCCTCCTGGCTGG + Intronic
1062362291 9:136193692-136193714 CCGCCCGCGCCCGCTCCAGCTGG - Intergenic
1062390842 9:136333288-136333310 CCCCCCGCGACCCTCCACCCAGG + Intronic
1062435793 9:136546092-136546114 CCGCCCGGCCCCACCCCCGCCGG + Intergenic
1062462307 9:136667033-136667055 CCCCCAGCCACCCTCCCCGCTGG + Intronic
1062529166 9:136992401-136992423 GCGCCCAAGCCCCGCCCCGCCGG + Exonic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062598071 9:137307943-137307965 CTGCCCCCGCCCCCGCCCGCCGG - Intronic
1062659092 9:137619063-137619085 GCCCCCGCGCCGCCCCCCGCCGG - Intronic
1203471277 Un_GL000220v1:116424-116446 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1203479098 Un_GL000220v1:160396-160418 CCGTCCTCCCCCCTCCCCGGGGG + Intergenic
1186670041 X:11758476-11758498 CCGGCCGCACCGCTCCTCGCAGG - Intronic
1189324851 X:40106032-40106054 CCACCCGCCCCCCTCCACGTAGG + Intronic
1189325813 X:40109900-40109922 CTGCACCCGCCTCTCCCCGCCGG + Intronic
1189717672 X:43882378-43882400 CAGCCCGCCCGCCTGCCCGCCGG + Exonic
1189717702 X:43882480-43882502 CCGCCCGCCCGCCTACGCGCAGG + Intergenic
1190048279 X:47129857-47129879 CCGCCCCCCCCCCACCCCCCCGG + Intergenic
1190385574 X:49879783-49879805 CCGCCACCGCCGCTCCGCGCTGG - Intergenic
1190709757 X:53058714-53058736 CCTCCCGTGCCCCACCCCACTGG - Intronic
1195802569 X:108730325-108730347 CCACCCCCGCACCCCCCCGCCGG + Intronic
1197754430 X:129984095-129984117 CCGCCCGCCCGCCCCGCCGCCGG - Intronic
1198088675 X:133305878-133305900 CCCCCCAAGCCCCTCCCAGCTGG - Exonic
1199649633 X:149939278-149939300 GCCCCCGAGCCCCTCCCCGGCGG - Intergenic
1199699625 X:150365545-150365567 CAGCGGGCGCCCCTCGCCGCCGG + Intronic
1199846299 X:151694968-151694990 GCGCCCGCGCCCCACTCTGCCGG - Intergenic
1199881172 X:151974947-151974969 CCGCCCAGGCCCCGCGCCGCGGG - Intergenic
1202604538 Y:26627370-26627392 CCGCCCTCGTCCCGTCCCGCAGG + Intergenic