ID: 1076554423

View in Genome Browser
Species Human (GRCh38)
Location 10:131312177-131312199
Sequence TCCAGGGCGCGGAGGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076554410_1076554423 12 Left 1076554410 10:131312142-131312164 CCGCGCGAGCCGCTCTCTACCTG No data
Right 1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG No data
1076554412_1076554423 3 Left 1076554412 10:131312151-131312173 CCGCTCTCTACCTGGCCTCCTCG No data
Right 1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG No data
1076554415_1076554423 -7 Left 1076554415 10:131312161-131312183 CCTGGCCTCCTCGGAGTCCAGGG No data
Right 1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076554423 Original CRISPR TCCAGGGCGCGGAGGGTACT GGG Intergenic
No off target data available for this crispr