ID: 1076555202

View in Genome Browser
Species Human (GRCh38)
Location 10:131316869-131316891
Sequence GGACCTCGATGCTGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076555202_1076555208 4 Left 1076555202 10:131316869-131316891 CCTCTGCCCCAGCATCGAGGTCC No data
Right 1076555208 10:131316896-131316918 GAGGCCTGACCCCCTTCATGAGG No data
1076555202_1076555214 17 Left 1076555202 10:131316869-131316891 CCTCTGCCCCAGCATCGAGGTCC No data
Right 1076555214 10:131316909-131316931 CTTCATGAGGCAACTCGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076555202 Original CRISPR GGACCTCGATGCTGGGGCAG AGG (reversed) Intergenic