ID: 1076558365

View in Genome Browser
Species Human (GRCh38)
Location 10:131344967-131344989
Sequence CGCGCCCTCCCTCCCACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076558365_1076558372 18 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG No data
Right 1076558372 10:131345008-131345030 CGTCACAGCAGGTCTGCTTCTGG No data
1076558365_1076558373 28 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG No data
Right 1076558373 10:131345018-131345040 GGTCTGCTTCTGGCCAGCCATGG No data
1076558365_1076558370 7 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG No data
Right 1076558370 10:131344997-131345019 ATTTTGAGATCCGTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076558365 Original CRISPR CGCGCCCTCCCTCCCACTTG TGG (reversed) Intergenic
No off target data available for this crispr