ID: 1076558369

View in Genome Browser
Species Human (GRCh38)
Location 10:131344995-131345017
Sequence TGCTGTGACGGATCTCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076558369_1076558372 -10 Left 1076558369 10:131344995-131345017 CCATTTTGAGATCCGTCACAGCA No data
Right 1076558372 10:131345008-131345030 CGTCACAGCAGGTCTGCTTCTGG No data
1076558369_1076558373 0 Left 1076558369 10:131344995-131345017 CCATTTTGAGATCCGTCACAGCA No data
Right 1076558373 10:131345018-131345040 GGTCTGCTTCTGGCCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076558369 Original CRISPR TGCTGTGACGGATCTCAAAA TGG (reversed) Intergenic