ID: 1076558370

View in Genome Browser
Species Human (GRCh38)
Location 10:131344997-131345019
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076558365_1076558370 7 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG No data
Right 1076558370 10:131344997-131345019 ATTTTGAGATCCGTCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076558370 Original CRISPR ATTTTGAGATCCGTCACAGC AGG Intergenic