ID: 1076558372

View in Genome Browser
Species Human (GRCh38)
Location 10:131345008-131345030
Sequence CGTCACAGCAGGTCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076558365_1076558372 18 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG No data
Right 1076558372 10:131345008-131345030 CGTCACAGCAGGTCTGCTTCTGG No data
1076558369_1076558372 -10 Left 1076558369 10:131344995-131345017 CCATTTTGAGATCCGTCACAGCA No data
Right 1076558372 10:131345008-131345030 CGTCACAGCAGGTCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076558372 Original CRISPR CGTCACAGCAGGTCTGCTTC TGG Intergenic