ID: 1076558372 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:131345008-131345030 |
Sequence | CGTCACAGCAGGTCTGCTTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076558365_1076558372 | 18 | Left | 1076558365 | 10:131344967-131344989 | CCACAAGTGGGAGGGAGGGCGCG | No data | ||
Right | 1076558372 | 10:131345008-131345030 | CGTCACAGCAGGTCTGCTTCTGG | No data | ||||
1076558369_1076558372 | -10 | Left | 1076558369 | 10:131344995-131345017 | CCATTTTGAGATCCGTCACAGCA | No data | ||
Right | 1076558372 | 10:131345008-131345030 | CGTCACAGCAGGTCTGCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076558372 | Original CRISPR | CGTCACAGCAGGTCTGCTTC TGG | Intergenic | ||