ID: 1076558373

View in Genome Browser
Species Human (GRCh38)
Location 10:131345018-131345040
Sequence GGTCTGCTTCTGGCCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076558369_1076558373 0 Left 1076558369 10:131344995-131345017 CCATTTTGAGATCCGTCACAGCA No data
Right 1076558373 10:131345018-131345040 GGTCTGCTTCTGGCCAGCCATGG No data
1076558365_1076558373 28 Left 1076558365 10:131344967-131344989 CCACAAGTGGGAGGGAGGGCGCG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1076558373 10:131345018-131345040 GGTCTGCTTCTGGCCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076558373 Original CRISPR GGTCTGCTTCTGGCCAGCCA TGG Intergenic