ID: 1076560907

View in Genome Browser
Species Human (GRCh38)
Location 10:131362911-131362933
Sequence CAAGACAGAGAAGCCATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076560907_1076560911 0 Left 1076560907 10:131362911-131362933 CCCCAGATGGCTTCTCTGTCTTG No data
Right 1076560911 10:131362934-131362956 AAGACTCAGAGGTCCCAGTATGG No data
1076560907_1076560915 25 Left 1076560907 10:131362911-131362933 CCCCAGATGGCTTCTCTGTCTTG No data
Right 1076560915 10:131362959-131362981 TCTGCCCAGGACAAACTCAGAGG No data
1076560907_1076560912 12 Left 1076560907 10:131362911-131362933 CCCCAGATGGCTTCTCTGTCTTG No data
Right 1076560912 10:131362946-131362968 TCCCAGTATGGTGTCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076560907 Original CRISPR CAAGACAGAGAAGCCATCTG GGG (reversed) Intergenic
No off target data available for this crispr