ID: 1076562507

View in Genome Browser
Species Human (GRCh38)
Location 10:131376482-131376504
Sequence AGCATCAGAGTTTTCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076562507_1076562509 3 Left 1076562507 10:131376482-131376504 CCATTACTGAAAACTCTGATGCT No data
Right 1076562509 10:131376508-131376530 GTATGTTCTCTTCATGGATTCGG No data
1076562507_1076562508 -3 Left 1076562507 10:131376482-131376504 CCATTACTGAAAACTCTGATGCT No data
Right 1076562508 10:131376502-131376524 GCTTATGTATGTTCTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076562507 Original CRISPR AGCATCAGAGTTTTCAGTAA TGG (reversed) Intergenic
No off target data available for this crispr