ID: 1076562508

View in Genome Browser
Species Human (GRCh38)
Location 10:131376502-131376524
Sequence GCTTATGTATGTTCTCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076562507_1076562508 -3 Left 1076562507 10:131376482-131376504 CCATTACTGAAAACTCTGATGCT No data
Right 1076562508 10:131376502-131376524 GCTTATGTATGTTCTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076562508 Original CRISPR GCTTATGTATGTTCTCTTCA TGG Intergenic
No off target data available for this crispr