ID: 1076563269

View in Genome Browser
Species Human (GRCh38)
Location 10:131381337-131381359
Sequence CACTCCAACAGCCCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076563269_1076563275 -3 Left 1076563269 10:131381337-131381359 CCCGCTGGGGGGCTGTTGGAGTG No data
Right 1076563275 10:131381357-131381379 GTGGCGGAGGAGAAGAGTCTGGG No data
1076563269_1076563277 23 Left 1076563269 10:131381337-131381359 CCCGCTGGGGGGCTGTTGGAGTG No data
Right 1076563277 10:131381383-131381405 CAGACCCCTGAACTTGAACCTGG No data
1076563269_1076563278 24 Left 1076563269 10:131381337-131381359 CCCGCTGGGGGGCTGTTGGAGTG No data
Right 1076563278 10:131381384-131381406 AGACCCCTGAACTTGAACCTGGG No data
1076563269_1076563282 30 Left 1076563269 10:131381337-131381359 CCCGCTGGGGGGCTGTTGGAGTG No data
Right 1076563282 10:131381390-131381412 CTGAACTTGAACCTGGGACCTGG No data
1076563269_1076563274 -4 Left 1076563269 10:131381337-131381359 CCCGCTGGGGGGCTGTTGGAGTG No data
Right 1076563274 10:131381356-131381378 AGTGGCGGAGGAGAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076563269 Original CRISPR CACTCCAACAGCCCCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr