ID: 1076563345

View in Genome Browser
Species Human (GRCh38)
Location 10:131381708-131381730
Sequence AGGAAAAGTCAGACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076563345_1076563352 10 Left 1076563345 10:131381708-131381730 CCTCCCTCTGTCTGACTTTTCCT No data
Right 1076563352 10:131381741-131381763 CCCAGTGTTCCAGTGCCCATCGG No data
1076563345_1076563355 21 Left 1076563345 10:131381708-131381730 CCTCCCTCTGTCTGACTTTTCCT No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076563345 Original CRISPR AGGAAAAGTCAGACAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr