ID: 1076563355

View in Genome Browser
Species Human (GRCh38)
Location 10:131381752-131381774
Sequence AGTGCCCATCGGTGTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076563347_1076563355 17 Left 1076563347 10:131381712-131381734 CCTCTGTCTGACTTTTCCTTCTG No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data
1076563345_1076563355 21 Left 1076563345 10:131381708-131381730 CCTCCCTCTGTCTGACTTTTCCT No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data
1076563344_1076563355 30 Left 1076563344 10:131381699-131381721 CCTGGTGCGCCTCCCTCTGTCTG No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data
1076563349_1076563355 1 Left 1076563349 10:131381728-131381750 CCTTCTGTGAGGCCCCAGTGTTC No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data
1076563346_1076563355 18 Left 1076563346 10:131381711-131381733 CCCTCTGTCTGACTTTTCCTTCT No data
Right 1076563355 10:131381752-131381774 AGTGCCCATCGGTGTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076563355 Original CRISPR AGTGCCCATCGGTGTGCCCA TGG Intergenic
No off target data available for this crispr