ID: 1076563621

View in Genome Browser
Species Human (GRCh38)
Location 10:131383298-131383320
Sequence CCCAGGCACGTGGGGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076563621_1076563634 21 Left 1076563621 10:131383298-131383320 CCAACCATCCCCACGTGCCTGGG No data
Right 1076563634 10:131383342-131383364 AGGCTTTCCATTTTAAAACCAGG No data
1076563621_1076563629 1 Left 1076563621 10:131383298-131383320 CCAACCATCCCCACGTGCCTGGG No data
Right 1076563629 10:131383322-131383344 CTGACCGATTCCCGCACGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076563621 Original CRISPR CCCAGGCACGTGGGGATGGT TGG (reversed) Intergenic
No off target data available for this crispr