ID: 1076565455

View in Genome Browser
Species Human (GRCh38)
Location 10:131395544-131395566
Sequence CCTCCCTGGACCTCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076565455_1076565460 0 Left 1076565455 10:131395544-131395566 CCTGCAGCTGAGGTCCAGGGAGG No data
Right 1076565460 10:131395567-131395589 TTCAATCCCTGTGCTCAATGGGG No data
1076565455_1076565464 20 Left 1076565455 10:131395544-131395566 CCTGCAGCTGAGGTCCAGGGAGG No data
Right 1076565464 10:131395587-131395609 GGGCAGGAGTCAGCACCTTCAGG No data
1076565455_1076565459 -1 Left 1076565455 10:131395544-131395566 CCTGCAGCTGAGGTCCAGGGAGG No data
Right 1076565459 10:131395566-131395588 GTTCAATCCCTGTGCTCAATGGG No data
1076565455_1076565458 -2 Left 1076565455 10:131395544-131395566 CCTGCAGCTGAGGTCCAGGGAGG No data
Right 1076565458 10:131395565-131395587 GGTTCAATCCCTGTGCTCAATGG No data
1076565455_1076565461 4 Left 1076565455 10:131395544-131395566 CCTGCAGCTGAGGTCCAGGGAGG No data
Right 1076565461 10:131395571-131395593 ATCCCTGTGCTCAATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076565455 Original CRISPR CCTCCCTGGACCTCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr