ID: 1076566121

View in Genome Browser
Species Human (GRCh38)
Location 10:131400659-131400681
Sequence CTGTGGCAGTGCAAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076566111_1076566121 1 Left 1076566111 10:131400635-131400657 CCCCAACCTGAGTGGGGAGGGTG No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566104_1076566121 10 Left 1076566104 10:131400626-131400648 CCTAGCCAGCCCCAACCTGAGTG No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566113_1076566121 -1 Left 1076566113 10:131400637-131400659 CCAACCTGAGTGGGGAGGGTGCC No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566108_1076566121 5 Left 1076566108 10:131400631-131400653 CCAGCCCCAACCTGAGTGGGGAG No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566112_1076566121 0 Left 1076566112 10:131400636-131400658 CCCAACCTGAGTGGGGAGGGTGC No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566114_1076566121 -5 Left 1076566114 10:131400641-131400663 CCTGAGTGGGGAGGGTGCCTGTG No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566103_1076566121 13 Left 1076566103 10:131400623-131400645 CCTCCTAGCCAGCCCCAACCTGA No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data
1076566102_1076566121 14 Left 1076566102 10:131400622-131400644 CCCTCCTAGCCAGCCCCAACCTG No data
Right 1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076566121 Original CRISPR CTGTGGCAGTGCAAAGGGGA GGG Intergenic
No off target data available for this crispr