ID: 1076567972

View in Genome Browser
Species Human (GRCh38)
Location 10:131411891-131411913
Sequence GGCCCCTAGAATCTCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076567957_1076567972 17 Left 1076567957 10:131411851-131411873 CCTCCAGCCGCCTGTCCCCACCC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567960_1076567972 7 Left 1076567960 10:131411861-131411883 CCTGTCCCCACCCACACCACCAC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567966_1076567972 -4 Left 1076567966 10:131411872-131411894 CCACACCACCACCTGCCAAGGCC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567956_1076567972 20 Left 1076567956 10:131411848-131411870 CCACCTCCAGCCGCCTGTCCCCA No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567955_1076567972 30 Left 1076567955 10:131411838-131411860 CCGGTCTGCTCCACCTCCAGCCG No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567967_1076567972 -9 Left 1076567967 10:131411877-131411899 CCACCACCTGCCAAGGCCCCTAG No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567963_1076567972 0 Left 1076567963 10:131411868-131411890 CCACCCACACCACCACCTGCCAA No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567958_1076567972 14 Left 1076567958 10:131411854-131411876 CCAGCCGCCTGTCCCCACCCACA No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567959_1076567972 10 Left 1076567959 10:131411858-131411880 CCGCCTGTCCCCACCCACACCAC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567965_1076567972 -3 Left 1076567965 10:131411871-131411893 CCCACACCACCACCTGCCAAGGC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567961_1076567972 2 Left 1076567961 10:131411866-131411888 CCCCACCCACACCACCACCTGCC No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data
1076567962_1076567972 1 Left 1076567962 10:131411867-131411889 CCCACCCACACCACCACCTGCCA No data
Right 1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076567972 Original CRISPR GGCCCCTAGAATCTCCCTTT GGG Intergenic
No off target data available for this crispr