ID: 1076568591

View in Genome Browser
Species Human (GRCh38)
Location 10:131415921-131415943
Sequence AAGGAGAAGGAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076568591_1076568597 19 Left 1076568591 10:131415921-131415943 CCCTTCTCCTTCTCCTTCTCCTT 0: 25
1: 106
2: 378
3: 1647
4: 6294
Right 1076568597 10:131415963-131415985 TTCCTCCCCTTCTCCTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076568591 Original CRISPR AAGGAGAAGGAGAAGGAGAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr