ID: 1076571523

View in Genome Browser
Species Human (GRCh38)
Location 10:131436261-131436283
Sequence CAGCCCCGAAGGTGTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076571523_1076571525 27 Left 1076571523 10:131436261-131436283 CCAGCAGGACACCTTCGGGGCTG No data
Right 1076571525 10:131436311-131436333 AACAAAAATGTTATTAGTTTTGG No data
1076571523_1076571526 28 Left 1076571523 10:131436261-131436283 CCAGCAGGACACCTTCGGGGCTG No data
Right 1076571526 10:131436312-131436334 ACAAAAATGTTATTAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076571523 Original CRISPR CAGCCCCGAAGGTGTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr