ID: 1076573118

View in Genome Browser
Species Human (GRCh38)
Location 10:131445451-131445473
Sequence CTGTCTGTGCAGTGGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076573118_1076573121 12 Left 1076573118 10:131445451-131445473 CCACAGGACCACTGCACAGACAG No data
Right 1076573121 10:131445486-131445508 GCAGACAGAGCTTTTGAAACTGG No data
1076573118_1076573122 26 Left 1076573118 10:131445451-131445473 CCACAGGACCACTGCACAGACAG No data
Right 1076573122 10:131445500-131445522 TGAAACTGGAATCTGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076573118 Original CRISPR CTGTCTGTGCAGTGGTCCTG TGG (reversed) Intergenic
No off target data available for this crispr