ID: 1076581288

View in Genome Browser
Species Human (GRCh38)
Location 10:131513612-131513634
Sequence GTCATGCCCCGAGGGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076581274_1076581288 23 Left 1076581274 10:131513566-131513588 CCTTCCCCTAGCCCTGTGCAGCC No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581282_1076581288 -5 Left 1076581282 10:131513594-131513616 CCAGAGAGGAAGAGCCCTGTCAT No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581278_1076581288 12 Left 1076581278 10:131513577-131513599 CCCTGTGCAGCCTCAGTCCAGAG No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581279_1076581288 11 Left 1076581279 10:131513578-131513600 CCTGTGCAGCCTCAGTCCAGAGA No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581277_1076581288 17 Left 1076581277 10:131513572-131513594 CCTAGCCCTGTGCAGCCTCAGTC No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581281_1076581288 2 Left 1076581281 10:131513587-131513609 CCTCAGTCCAGAGAGGAAGAGCC No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581276_1076581288 18 Left 1076581276 10:131513571-131513593 CCCTAGCCCTGTGCAGCCTCAGT No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data
1076581275_1076581288 19 Left 1076581275 10:131513570-131513592 CCCCTAGCCCTGTGCAGCCTCAG No data
Right 1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076581288 Original CRISPR GTCATGCCCCGAGGGGCTCC AGG Intergenic
No off target data available for this crispr