ID: 1076584843

View in Genome Browser
Species Human (GRCh38)
Location 10:131539653-131539675
Sequence TGTACCTCCACTGCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076584843_1076584849 0 Left 1076584843 10:131539653-131539675 CCTCCCACAGCAGTGGAGGTACA No data
Right 1076584849 10:131539676-131539698 GGGGCTGCAGACCTGCCGCCAGG No data
1076584843_1076584853 21 Left 1076584843 10:131539653-131539675 CCTCCCACAGCAGTGGAGGTACA No data
Right 1076584853 10:131539697-131539719 GGCGAGCACTTCCCAGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076584843 Original CRISPR TGTACCTCCACTGCTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr