ID: 1076585878

View in Genome Browser
Species Human (GRCh38)
Location 10:131547402-131547424
Sequence TTGAACACCCTGTCCTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076585878_1076585885 12 Left 1076585878 10:131547402-131547424 CCATGCCAGGACAGGGTGTTCAA No data
Right 1076585885 10:131547437-131547459 AAGATAGAGTGCCCACCTAGAGG No data
1076585878_1076585892 28 Left 1076585878 10:131547402-131547424 CCATGCCAGGACAGGGTGTTCAA No data
Right 1076585892 10:131547453-131547475 CTAGAGGGATATGTACAACGGGG No data
1076585878_1076585886 13 Left 1076585878 10:131547402-131547424 CCATGCCAGGACAGGGTGTTCAA No data
Right 1076585886 10:131547438-131547460 AGATAGAGTGCCCACCTAGAGGG No data
1076585878_1076585889 26 Left 1076585878 10:131547402-131547424 CCATGCCAGGACAGGGTGTTCAA No data
Right 1076585889 10:131547451-131547473 ACCTAGAGGGATATGTACAACGG No data
1076585878_1076585891 27 Left 1076585878 10:131547402-131547424 CCATGCCAGGACAGGGTGTTCAA No data
Right 1076585891 10:131547452-131547474 CCTAGAGGGATATGTACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076585878 Original CRISPR TTGAACACCCTGTCCTGGCA TGG (reversed) Intergenic
No off target data available for this crispr