ID: 1076585962

View in Genome Browser
Species Human (GRCh38)
Location 10:131547820-131547842
Sequence AGGGGCCTTCTCAGAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076585957_1076585962 -10 Left 1076585957 10:131547807-131547829 CCCAGGGAGCCACAGGGGCCTTC No data
Right 1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076585962 Original CRISPR AGGGGCCTTCTCAGAGGAAA GGG Intergenic
No off target data available for this crispr