ID: 1076590411

View in Genome Browser
Species Human (GRCh38)
Location 10:131578469-131578491
Sequence TGGCCAGTGGACTCCCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076590411_1076590420 11 Left 1076590411 10:131578469-131578491 CCTCCGTGGGAGTCCACTGGCCA No data
Right 1076590420 10:131578503-131578525 AGAGCAAGGCCGAGGCGATCTGG No data
1076590411_1076590419 3 Left 1076590411 10:131578469-131578491 CCTCCGTGGGAGTCCACTGGCCA No data
Right 1076590419 10:131578495-131578517 TCAGGGCGAGAGCAAGGCCGAGG No data
1076590411_1076590422 30 Left 1076590411 10:131578469-131578491 CCTCCGTGGGAGTCCACTGGCCA No data
Right 1076590422 10:131578522-131578544 CTGGCCGCCTCACCTCCTCCTGG No data
1076590411_1076590418 -3 Left 1076590411 10:131578469-131578491 CCTCCGTGGGAGTCCACTGGCCA No data
Right 1076590418 10:131578489-131578511 CCACGGTCAGGGCGAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076590411 Original CRISPR TGGCCAGTGGACTCCCACGG AGG (reversed) Intergenic
No off target data available for this crispr