ID: 1076597026

View in Genome Browser
Species Human (GRCh38)
Location 10:131630112-131630134
Sequence CAGGTCCCTGAAAATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076597018_1076597026 24 Left 1076597018 10:131630065-131630087 CCTTTCTCACCTAACTAACTGCA No data
Right 1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG No data
1076597020_1076597026 15 Left 1076597020 10:131630074-131630096 CCTAACTAACTGCAGGTAGACAG No data
Right 1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076597026 Original CRISPR CAGGTCCCTGAAAATGGGCA GGG Intergenic
No off target data available for this crispr