ID: 1076598268

View in Genome Browser
Species Human (GRCh38)
Location 10:131639142-131639164
Sequence CATTCTGAGGACAAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076598268_1076598273 25 Left 1076598268 10:131639142-131639164 CCTGTCCCTTTGTCCTCAGAATG No data
Right 1076598273 10:131639190-131639212 ACACCCAGCACCTCCATTGCCGG No data
1076598268_1076598276 30 Left 1076598268 10:131639142-131639164 CCTGTCCCTTTGTCCTCAGAATG No data
Right 1076598276 10:131639195-131639217 CAGCACCTCCATTGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076598268 Original CRISPR CATTCTGAGGACAAAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr