ID: 1076599243

View in Genome Browser
Species Human (GRCh38)
Location 10:131646442-131646464
Sequence AGGACCAACGTGGGTGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076599243_1076599248 -9 Left 1076599243 10:131646442-131646464 CCGTCTGCACCCACGTTGGTCCT No data
Right 1076599248 10:131646456-131646478 GTTGGTCCTGTTCAGCTTTGGGG No data
1076599243_1076599247 -10 Left 1076599243 10:131646442-131646464 CCGTCTGCACCCACGTTGGTCCT No data
Right 1076599247 10:131646455-131646477 CGTTGGTCCTGTTCAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076599243 Original CRISPR AGGACCAACGTGGGTGCAGA CGG (reversed) Intergenic
No off target data available for this crispr