ID: 1076599368

View in Genome Browser
Species Human (GRCh38)
Location 10:131647020-131647042
Sequence GCTGAGAGCCGGCCCCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076599357_1076599368 23 Left 1076599357 10:131646974-131646996 CCCGAGATCCCCGGCTGGGCCGT No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data
1076599360_1076599368 14 Left 1076599360 10:131646983-131647005 CCCGGCTGGGCCGTTGTTTGCAG No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data
1076599361_1076599368 13 Left 1076599361 10:131646984-131647006 CCGGCTGGGCCGTTGTTTGCAGG No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data
1076599363_1076599368 4 Left 1076599363 10:131646993-131647015 CCGTTGTTTGCAGGCATTCCCAC No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data
1076599359_1076599368 15 Left 1076599359 10:131646982-131647004 CCCCGGCTGGGCCGTTGTTTGCA No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data
1076599358_1076599368 22 Left 1076599358 10:131646975-131646997 CCGAGATCCCCGGCTGGGCCGTT No data
Right 1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076599368 Original CRISPR GCTGAGAGCCGGCCCCTAGC AGG Intergenic
No off target data available for this crispr