ID: 1076600698

View in Genome Browser
Species Human (GRCh38)
Location 10:131655143-131655165
Sequence CTTCCATGACCTAAGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076600698_1076600702 7 Left 1076600698 10:131655143-131655165 CCACGTTCCTTAGGTCATGGAAG No data
Right 1076600702 10:131655173-131655195 AATCCTCCTGCAATAAAAGCTGG No data
1076600698_1076600706 30 Left 1076600698 10:131655143-131655165 CCACGTTCCTTAGGTCATGGAAG No data
Right 1076600706 10:131655196-131655218 AGCAGTGCTGGCTTCTGAGTTGG No data
1076600698_1076600705 18 Left 1076600698 10:131655143-131655165 CCACGTTCCTTAGGTCATGGAAG No data
Right 1076600705 10:131655184-131655206 AATAAAAGCTGGAGCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076600698 Original CRISPR CTTCCATGACCTAAGGAACG TGG (reversed) Intergenic
No off target data available for this crispr