ID: 1076604127

View in Genome Browser
Species Human (GRCh38)
Location 10:131678312-131678334
Sequence CTGGAGCAGGCCAGAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604127_1076604135 -4 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604135 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
1076604127_1076604139 18 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604139 10:131678353-131678375 GTAGATGGCGCCCCCCGCACAGG No data
1076604127_1076604136 3 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604136 10:131678338-131678360 CGGCGCGGCTCCCTGGTAGATGG No data
1076604127_1076604140 27 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604140 10:131678362-131678384 GCCCCCCGCACAGGCCGCCGTGG No data
1076604127_1076604142 28 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604127 Original CRISPR CTGGAGCAGGCCAGAGGGGC TGG (reversed) Intergenic