ID: 1076604128

View in Genome Browser
Species Human (GRCh38)
Location 10:131678316-131678338
Sequence GATGCTGGAGCAGGCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604128_1076604147 30 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604147 10:131678369-131678391 GCACAGGCCGCCGTGGGCAGTGG No data
1076604128_1076604136 -1 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604136 10:131678338-131678360 CGGCGCGGCTCCCTGGTAGATGG No data
1076604128_1076604135 -8 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604135 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
1076604128_1076604142 24 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604128_1076604139 14 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604139 10:131678353-131678375 GTAGATGGCGCCCCCCGCACAGG No data
1076604128_1076604140 23 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604140 10:131678362-131678384 GCCCCCCGCACAGGCCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604128 Original CRISPR GATGCTGGAGCAGGCCAGAG GGG (reversed) Intergenic