ID: 1076604133

View in Genome Browser
Species Human (GRCh38)
Location 10:131678325-131678347
Sequence AGCCGCGCCGATGCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604133_1076604142 15 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604133_1076604147 21 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604147 10:131678369-131678391 GCACAGGCCGCCGTGGGCAGTGG No data
1076604133_1076604136 -10 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604136 10:131678338-131678360 CGGCGCGGCTCCCTGGTAGATGG No data
1076604133_1076604149 26 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604149 10:131678374-131678396 GGCCGCCGTGGGCAGTGGTTGGG No data
1076604133_1076604139 5 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604139 10:131678353-131678375 GTAGATGGCGCCCCCCGCACAGG No data
1076604133_1076604148 25 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604148 10:131678373-131678395 AGGCCGCCGTGGGCAGTGGTTGG No data
1076604133_1076604140 14 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604140 10:131678362-131678384 GCCCCCCGCACAGGCCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604133 Original CRISPR AGCCGCGCCGATGCTGGAGC AGG (reversed) Intergenic