ID: 1076604134

View in Genome Browser
Species Human (GRCh38)
Location 10:131678331-131678353
Sequence CCAGGGAGCCGCGCCGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604134_1076604148 19 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604148 10:131678373-131678395 AGGCCGCCGTGGGCAGTGGTTGG No data
1076604134_1076604139 -1 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604139 10:131678353-131678375 GTAGATGGCGCCCCCCGCACAGG No data
1076604134_1076604140 8 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604140 10:131678362-131678384 GCCCCCCGCACAGGCCGCCGTGG No data
1076604134_1076604147 15 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604147 10:131678369-131678391 GCACAGGCCGCCGTGGGCAGTGG No data
1076604134_1076604149 20 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604149 10:131678374-131678396 GGCCGCCGTGGGCAGTGGTTGGG No data
1076604134_1076604153 26 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604153 10:131678380-131678402 CGTGGGCAGTGGTTGGGTGTGGG No data
1076604134_1076604142 9 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604134_1076604152 25 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604152 10:131678379-131678401 CCGTGGGCAGTGGTTGGGTGTGG No data
1076604134_1076604154 29 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604154 10:131678383-131678405 GGGCAGTGGTTGGGTGTGGGTGG No data
1076604134_1076604155 30 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604155 10:131678384-131678406 GGCAGTGGTTGGGTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604134 Original CRISPR CCAGGGAGCCGCGCCGATGC TGG (reversed) Intergenic