ID: 1076604137

View in Genome Browser
Species Human (GRCh38)
Location 10:131678348-131678370
Sequence GCGGGGGGCGCCATCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604137_1076604148 2 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604148 10:131678373-131678395 AGGCCGCCGTGGGCAGTGGTTGG No data
1076604137_1076604159 27 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604159 10:131678398-131678420 GTGGGTGGGGAATGGCCGCCGGG No data
1076604137_1076604155 13 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604155 10:131678384-131678406 GGCAGTGGTTGGGTGTGGGTGGG No data
1076604137_1076604154 12 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604154 10:131678383-131678405 GGGCAGTGGTTGGGTGTGGGTGG No data
1076604137_1076604147 -2 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604147 10:131678369-131678391 GCACAGGCCGCCGTGGGCAGTGG No data
1076604137_1076604152 8 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604152 10:131678379-131678401 CCGTGGGCAGTGGTTGGGTGTGG No data
1076604137_1076604140 -9 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604140 10:131678362-131678384 GCCCCCCGCACAGGCCGCCGTGG No data
1076604137_1076604149 3 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604149 10:131678374-131678396 GGCCGCCGTGGGCAGTGGTTGGG No data
1076604137_1076604156 14 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604156 10:131678385-131678407 GCAGTGGTTGGGTGTGGGTGGGG No data
1076604137_1076604153 9 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604153 10:131678380-131678402 CGTGGGCAGTGGTTGGGTGTGGG No data
1076604137_1076604158 26 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604158 10:131678397-131678419 TGTGGGTGGGGAATGGCCGCCGG No data
1076604137_1076604142 -8 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604137_1076604157 19 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604157 10:131678390-131678412 GGTTGGGTGTGGGTGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604137 Original CRISPR GCGGGGGGCGCCATCTACCA GGG (reversed) Intergenic