ID: 1076604142

View in Genome Browser
Species Human (GRCh38)
Location 10:131678363-131678385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076604137_1076604142 -8 Left 1076604137 10:131678348-131678370 CCCTGGTAGATGGCGCCCCCCGC No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604130_1076604142 22 Left 1076604130 10:131678318-131678340 CCTCTGGCCTGCTCCAGCATCGG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604127_1076604142 28 Left 1076604127 10:131678312-131678334 CCAGCCCCTCTGGCCTGCTCCAG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604128_1076604142 24 Left 1076604128 10:131678316-131678338 CCCCTCTGGCCTGCTCCAGCATC No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604134_1076604142 9 Left 1076604134 10:131678331-131678353 CCAGCATCGGCGCGGCTCCCTGG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604129_1076604142 23 Left 1076604129 10:131678317-131678339 CCCTCTGGCCTGCTCCAGCATCG No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604133_1076604142 15 Left 1076604133 10:131678325-131678347 CCTGCTCCAGCATCGGCGCGGCT No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data
1076604138_1076604142 -9 Left 1076604138 10:131678349-131678371 CCTGGTAGATGGCGCCCCCCGCA No data
Right 1076604142 10:131678363-131678385 CCCCCCGCACAGGCCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076604142 Original CRISPR CCCCCCGCACAGGCCGCCGT GGG Intergenic
No off target data available for this crispr